ID: 1094617571

View in Genome Browser
Species Human (GRCh38)
Location 12:32049616-32049638
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094617567_1094617571 10 Left 1094617567 12:32049583-32049605 CCCAGAGAGAACAAGAACAGAAA No data
Right 1094617571 12:32049616-32049638 GTCCATCTGTCTGCCAGAGCTGG No data
1094617568_1094617571 9 Left 1094617568 12:32049584-32049606 CCAGAGAGAACAAGAACAGAAAG No data
Right 1094617571 12:32049616-32049638 GTCCATCTGTCTGCCAGAGCTGG No data
1094617566_1094617571 25 Left 1094617566 12:32049568-32049590 CCAACTTGCTGGGGGCCCAGAGA No data
Right 1094617571 12:32049616-32049638 GTCCATCTGTCTGCCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094617571 Original CRISPR GTCCATCTGTCTGCCAGAGC TGG Intergenic