ID: 1094618878

View in Genome Browser
Species Human (GRCh38)
Location 12:32060920-32060942
Sequence TTCCCGAAGGGGCTGGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094618878_1094618885 -9 Left 1094618878 12:32060920-32060942 CCTCTCACCAGCCCCTTCGGGAA No data
Right 1094618885 12:32060934-32060956 CTTCGGGAAGGCTGGAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094618878 Original CRISPR TTCCCGAAGGGGCTGGTGAG AGG (reversed) Intergenic
No off target data available for this crispr