ID: 1094625796

View in Genome Browser
Species Human (GRCh38)
Location 12:32123025-32123047
Sequence GCGGAGCCTACATTTTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094625796 Original CRISPR GCGGAGCCTACATTTTGTGG GGG Intronic
903932344 1:26870038-26870060 GCTGGGCCTCCATTTTCTGGGGG - Intergenic
907275876 1:53316443-53316465 GCAGAGCCTACATCTACTGGAGG - Intronic
908501352 1:64745756-64745778 GTGGAGCACACATTTTGCGGGGG + Intronic
919365857 1:196659941-196659963 GGGGAGCTTACATTTTGATGTGG + Intronic
1063294693 10:4792966-4792988 CCTGAGCTTTCATTTTGTGGTGG + Intronic
1065101334 10:22335474-22335496 CCGGAGCCGCCATTTGGTGGCGG + Intergenic
1066593471 10:37021887-37021909 GTGGAGCTTACATTCTGTGTTGG - Intergenic
1068287027 10:54950985-54951007 GGGGAACCTATATTTTGTAGGGG - Intronic
1070408991 10:76121965-76121987 GAGGAGCTTGCATTTTGGGGTGG + Intronic
1073124631 10:101141667-101141689 GGGGTACCTACATTTTGTTGAGG + Intergenic
1080262637 11:30366095-30366117 GTGGATCTTACATTCTGTGGAGG + Intergenic
1089220662 11:116868684-116868706 GGGGAACCAACATTCTGTGGAGG + Intronic
1091300539 11:134504408-134504430 AATGAGCCTACATTTTGTTGGGG + Intergenic
1092255770 12:6926158-6926180 GAGGAGCCTGCAGTCTGTGGTGG + Intronic
1094625796 12:32123025-32123047 GCGGAGCCTACATTTTGTGGGGG + Intronic
1106466300 13:30017414-30017436 GCGGAGCCAACACTTGGAGGCGG - Intergenic
1107608461 13:42086887-42086909 GAGGAGGCTAGAATTTGTGGGGG + Intronic
1107783313 13:43927998-43928020 GCGTAGCCTTCAGTCTGTGGTGG - Intergenic
1107955005 13:45503452-45503474 GAGGAGCCCACACTTTATGGGGG + Intronic
1109227900 13:59718906-59718928 GGGGGGGCTACATTTTGAGGTGG - Intronic
1116291668 14:43051049-43051071 AAGGAGCTTACATTTTGTGGGGG + Intergenic
1125255982 15:37763389-37763411 TTGGATCTTACATTTTGTGGAGG - Intergenic
1129323965 15:74789877-74789899 GCCGGGTCTGCATTTTGTGGTGG + Intronic
1129859685 15:78850969-78850991 GTGGAGTCTCCACTTTGTGGAGG - Intronic
1130772566 15:86939436-86939458 GTGCAGCCTTCAGTTTGTGGCGG - Intronic
1137565294 16:49528926-49528948 GCGGACCCTGCATCTTGGGGTGG - Intronic
1137906277 16:52325282-52325304 GTGCAGCCTTCAGTTTGTGGTGG - Intergenic
1144466269 17:15499996-15500018 TCGGAGCCCACATTTTGTTCAGG + Intronic
1146785617 17:35718426-35718448 GAGGAGCATACATTTTATGAGGG - Intronic
1153102234 18:1486774-1486796 GCGAAAGCTACATTTTGTGTAGG + Intergenic
1154400819 18:14034980-14035002 GGGGAGTCTACATTGTGGGGAGG - Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1158527355 18:58227171-58227193 GCGGAGCCTACATTTTACCAAGG - Intronic
1162394251 19:10407213-10407235 GTGGAGCTGACATTTAGTGGAGG + Intronic
1162520790 19:11178355-11178377 GAGGAGCCTCCAGTTCGTGGGGG - Exonic
1164396765 19:27872243-27872265 GTGGAGCCTACATTATGAAGGGG - Intergenic
1165305159 19:34999205-34999227 GTGGAGCCCACAGTTTGTGACGG + Intronic
1167335015 19:48879754-48879776 GAGGAGCCTGCATTCTGTGAAGG - Intergenic
1168150500 19:54444978-54445000 GCGCAGCCTTCAGTCTGTGGCGG - Intergenic
926085923 2:10020293-10020315 GCGGGGCCTATTTTTTGGGGGGG + Intergenic
935896377 2:107742359-107742381 GTGGTCCCTACATTTTCTGGGGG + Intergenic
1173505570 20:43584525-43584547 ATGGAGCTTACATTGTGTGGGGG - Intronic
972715187 4:41639112-41639134 GCAGAGCATACATTCTGTGCAGG + Intronic
975016396 4:69425941-69425963 CCTTAGCCTACATTTTGTTGGGG + Intergenic
983906481 4:173188294-173188316 GCAGAGCCTACCTTTTCAGGTGG + Intronic
985767696 5:1788528-1788550 ACAGAGATTACATTTTGTGGTGG + Intergenic
986325946 5:6674680-6674702 GAGGAGACTACATTGTGAGGAGG - Intergenic
987910732 5:24140960-24140982 GAGGACACTACATTTTGTGCTGG + Intronic
990245072 5:53856513-53856535 GTGCAGCCTTCATTCTGTGGTGG + Intergenic
992314208 5:75536239-75536261 TCTGTGCCTACATTTTTTGGGGG + Intronic
1009903553 6:69839937-69839959 TTGGAGCTTACATTTTGTAGTGG - Intergenic
1026989415 7:74575123-74575145 ACGGAGCCTACATGGTGGGGCGG + Intronic
1029957933 7:104659273-104659295 GAGGAGCCAACAGTCTGTGGGGG - Intronic
1031984207 7:128152444-128152466 GCTGAGTCTAGATTTTGTGGGGG - Intergenic
1032255178 7:130291514-130291536 GCTGAGCCCACGCTTTGTGGTGG + Intergenic
1034939507 7:155221143-155221165 GCGCAGCCTACAGGGTGTGGGGG - Intergenic
1036971767 8:13363073-13363095 ACAGAGCCTACACTTTGTGGGGG + Intronic
1048011378 8:130459211-130459233 GTGGAGCCTACATTCTGGTGGGG + Intergenic
1048253028 8:132882981-132883003 GGGGAGCCGCCATCTTGTGGTGG + Exonic
1060072775 9:120564888-120564910 GCGGAGGCAGCATTTTGTGAAGG - Intronic
1194643701 X:96432443-96432465 GTGGAGCTTACATTCTATGGGGG - Intergenic
1198162818 X:134024391-134024413 GTGGACCCTACATTTTTTAGAGG - Intergenic
1200930631 Y:8693817-8693839 GCACAGCCTTCTTTTTGTGGAGG - Intergenic