ID: 1094631530

View in Genome Browser
Species Human (GRCh38)
Location 12:32180231-32180253
Sequence GGTCCAGGCAGGAAATCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094631530_1094631538 15 Left 1094631530 12:32180231-32180253 CCAGAGGATTTCCTGCCTGGACC 0: 1
1: 0
2: 1
3: 15
4: 145
Right 1094631538 12:32180269-32180291 CGCTACATATTTCCCAGCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094631530 Original CRISPR GGTCCAGGCAGGAAATCCTC TGG (reversed) Intronic
900483047 1:2908660-2908682 GGTCCAGGCAGGAGACACCCAGG - Intergenic
901547247 1:9967581-9967603 GTTCCAGAAAGAAAATCCTCTGG + Intronic
902432749 1:16376128-16376150 GGTCCGGGGAGGAAATCATGTGG + Intronic
903672857 1:25046743-25046765 GGGCCACGCAGGACGTCCTCTGG + Intergenic
905897881 1:41560571-41560593 CGGCCAGGCTGGAAAACCTCTGG + Intronic
913975124 1:143449852-143449874 TCTCCAGGGAGGAAATCCTGCGG + Intergenic
914069516 1:144275468-144275490 TCTCCAGGGAGGAAATCCTGCGG + Intergenic
914109639 1:144690886-144690908 TCTCCAGGGAGGAAATCCTGCGG - Intergenic
915921284 1:159977681-159977703 GGTCTAGGCGAGAAAGCCTCAGG - Intergenic
916691078 1:167190578-167190600 GGGCCAGGCAGTCACTCCTCTGG + Intergenic
918402066 1:184173506-184173528 GGAGGAGGCAGGGAATCCTCAGG - Intergenic
919777196 1:201201962-201201984 GGTCCAGCCAGGAACTCCATGGG - Intronic
919820309 1:201468329-201468351 GGTCAAGGCAGGTAAGCCCCCGG - Exonic
920075066 1:203330186-203330208 GGTGCAGGCAGGAAAGCATCAGG - Intergenic
921123562 1:212157530-212157552 GAGCCAGGCAGGAAATCTACTGG - Intergenic
1064296045 10:14080024-14080046 GGTCCAGGCAGGAGGTCCAAGGG - Intronic
1072426884 10:95337434-95337456 TGTCCAAAAAGGAAATCCTCAGG + Intronic
1074531284 10:114300534-114300556 TGTCCAGGCAGGACAACGTCGGG + Exonic
1074947831 10:118298235-118298257 GAGCCAGACAGGAAATCCACTGG + Exonic
1075663576 10:124215137-124215159 CTTCCAGGCAGCAAATCCACAGG - Intergenic
1075714424 10:124547933-124547955 TGTCCAGGCAGGGCAGCCTCTGG + Intronic
1075850242 10:125580863-125580885 GCTCCAGGCAGGAAAGTCCCAGG - Intronic
1077251062 11:1560921-1560943 GGTAAAGGCAGGAAAGTCTCTGG + Intronic
1077295772 11:1825627-1825649 GCTCCAGGCCCGAAACCCTCTGG + Intergenic
1078266392 11:9758716-9758738 GGTCCCGGCCGGAAATCCTCAGG - Intergenic
1081485922 11:43528850-43528872 GGTAGAGGCAGCAACTCCTCTGG + Intergenic
1083485905 11:62982892-62982914 GCTCCAGGCAGGAGATCCTAGGG - Intronic
1083711815 11:64554377-64554399 TCTCCAGGCAGGAAATCATTAGG - Intergenic
1083943698 11:65912230-65912252 GGTCAAGGCTAGAAATGCTCTGG - Intergenic
1091166446 11:133480314-133480336 GGACAAGGCAGGCAACCCTCCGG - Intronic
1091283786 11:134397065-134397087 GGTCCCGGCATGAAAACCTCAGG + Intronic
1092218782 12:6699629-6699651 GGTCCAGGCAGGACAGCCAGAGG + Intronic
1093611327 12:21161905-21161927 GGCCGAGGCAGGAAAATCTCTGG + Intronic
1094631530 12:32180231-32180253 GGTCCAGGCAGGAAATCCTCTGG - Intronic
1096487645 12:51994485-51994507 GGTCCCCGAAGGAAACCCTCAGG - Intronic
1097575492 12:61388284-61388306 GGGCCTGGCAGGAAATGTTCAGG - Intergenic
1101583585 12:106065690-106065712 GGTTCAGCCAGGTAATCCTCTGG + Exonic
1101645916 12:106630775-106630797 ACTCCAGGCAGGAAATATTCTGG + Intronic
1101750403 12:107578796-107578818 GATTCAGGCAGAAAATCCTTGGG + Intronic
1101752723 12:107596237-107596259 GGGCCAGGCAGGAAACACACGGG + Intronic
1103070939 12:117941272-117941294 GGGCCAGGCAGGAAACCCACAGG - Intronic
1104240207 12:126981133-126981155 GATCCATGCTGGGAATCCTCAGG + Intergenic
1104785246 12:131444609-131444631 GGTCCAGGCTGTAAGTCCACTGG + Intergenic
1104818029 12:131659867-131659889 GGTCCAGGCAGGAAAAGAGCAGG - Intergenic
1106185340 13:27404902-27404924 GGTCCCGGCAGGAAGTCTGCGGG + Intergenic
1109893129 13:68644788-68644810 GGCACAGGCAGCAAAGCCTCCGG - Intergenic
1112528590 13:100178610-100178632 GGTTCAGGCAGCATTTCCTCTGG + Intronic
1114214232 14:20643762-20643784 GGTCCAGACAGGAAAATATCTGG + Intergenic
1114882485 14:26804038-26804060 GGTTAAGGCAGGAAATCTTGTGG - Intergenic
1117605167 14:57421533-57421555 GCTACTGGCAGGCAATCCTCAGG + Intergenic
1119582983 14:75804228-75804250 GGACCAGGCAGGGAAGTCTCAGG - Intronic
1120568737 14:86091778-86091800 GTTGCAGGCAAGAAACCCTCAGG - Intergenic
1122427288 14:101619495-101619517 GGTCCAGGCAGAAAACTCTGGGG + Intergenic
1129743015 15:77999260-77999282 GGGACAGGCAGGAAGTCCTTCGG - Intronic
1129842463 15:78752179-78752201 GGGACAGGCAGGAAGTCCTTCGG + Intergenic
1129911063 15:79226817-79226839 TGTCCAGGCAGGAAATTATGTGG - Intergenic
1130307672 15:82725474-82725496 TGTCCTGGCAGGAAAACATCAGG + Intergenic
1132253222 15:100350080-100350102 GAGCCAGGCAGGAAGGCCTCGGG - Intergenic
1132515014 16:362194-362216 GGTCCAGGGAGCAAGGCCTCGGG - Intergenic
1132590089 16:722768-722790 GGTACAAGCACGAAATCCTGAGG - Exonic
1134414435 16:14031288-14031310 GGCTAAGGCAGGAAACCCTCTGG + Intergenic
1137017624 16:35393234-35393256 CGTCCAGGCCTGAAAGCCTCAGG + Intergenic
1138083759 16:54115590-54115612 GGCCCAGGCAGGAGAGCCTTGGG + Exonic
1141606718 16:85158252-85158274 GGGACAGGCAGGAATTCATCAGG + Intergenic
1141656551 16:85419816-85419838 GGGCCAGCCAGGAACTCCACAGG + Intergenic
1142598374 17:1040437-1040459 GGTCATGGCAGGGAAACCTCGGG + Intronic
1143252378 17:5533068-5533090 GGTCCAGGCAGGCCAGCCTTGGG - Intronic
1144968691 17:19093738-19093760 GGCCCAGGCAGGGACCCCTCTGG + Exonic
1144979223 17:19158328-19158350 GGCCCAGGCAGGGACCCCTCTGG - Exonic
1144988999 17:19219904-19219926 GGCCCAGGCAGGGACCCCTCTGG + Exonic
1145007863 17:19347688-19347710 GGTTCAGGCTGGGAATGCTCTGG - Intronic
1145241180 17:21241798-21241820 CGTCCAGGCAGGAAGGCCCCTGG + Exonic
1149638626 17:58189478-58189500 GGTCCAGGCTGGAAAGCCCCTGG + Intergenic
1151459005 17:74243724-74243746 GGTCCGTGCATGAAAGCCTCTGG + Intronic
1152782651 17:82233004-82233026 GCTCCAGGCAGGACAGCCCCAGG + Intronic
1153140959 18:1972038-1972060 GGTTCAGGTTGGAAAGCCTCAGG - Intergenic
1154271516 18:12924785-12924807 GCTCGATGCAGGAAAACCTCGGG + Intronic
1157557097 18:48619904-48619926 GATCCAGGCAGGAAGTGCCCTGG + Intronic
1158879629 18:61764874-61764896 TATCCAGGCAGTAAAACCTCAGG - Intergenic
1159601951 18:70436520-70436542 GGGCCAGGCAGGAACCCCTAGGG + Intergenic
1161330530 19:3684766-3684788 GGCCCAGGCAGCAAAGCCCCGGG + Intronic
1161454402 19:4362903-4362925 GGTCCAGGCTGGAGGCCCTCTGG - Intronic
1161633221 19:5369967-5369989 GGTCCAGGCAGGCAATGATGGGG - Intergenic
1163179875 19:15591885-15591907 GGTCCTGGCAGGGAACCCACAGG + Intergenic
1163316343 19:16542777-16542799 GGCCCAGGCACGAAGTCCCCAGG - Intronic
1165123080 19:33575278-33575300 GTTCCAGGAGGGAAATCCTCAGG + Intergenic
925055696 2:855405-855427 GTTCCACACAGGAAATCCTCAGG - Intergenic
931748113 2:65308211-65308233 GGTTCAGGCAGGCAGTACTCTGG + Intergenic
933627635 2:84619724-84619746 GGCCCAGACACGAAATCCACAGG + Exonic
934039724 2:88117768-88117790 GGTCCAGGCAAGAGATGCTGGGG - Intergenic
934097916 2:88624690-88624712 GGTGCAGGCAGGACATCCAGAGG - Intronic
934290117 2:91685086-91685108 TCTCCAGGGAGGAAATCCTGCGG + Intergenic
936648995 2:114404751-114404773 GTTCCAGACAGGACAGCCTCTGG + Intergenic
944390175 2:199209824-199209846 TGTCCAGGCAAGAAATCATGAGG - Intergenic
947800213 2:232924599-232924621 GCTCCAGGCATCACATCCTCAGG - Intronic
948481269 2:238252024-238252046 GCTCCAGGGGGGAAAGCCTCAGG + Intronic
1170607336 20:17883886-17883908 GGGCCAGGCAGGGAATGTTCGGG - Intergenic
1172234154 20:33358544-33358566 GGTCCATGAGGGAAATCCTCAGG + Intergenic
1172782695 20:37446642-37446664 GGTCCAGGCATGAGATGCTAAGG - Intergenic
1172815394 20:37682200-37682222 TGTCGAGGCAGGAAATGCTTGGG - Intergenic
1172942516 20:38664148-38664170 GGTGCAGGCAGGAACCCCCCAGG + Intergenic
1175367158 20:58463699-58463721 AGTCCAGGCAGGACAGCCACAGG + Intronic
1176121911 20:63457849-63457871 GGCCCTGGCAGGAAACCCGCTGG + Intronic
1179791695 21:43759596-43759618 GGCCCAGGCAGGCGATCCACAGG - Exonic
1180879146 22:19191647-19191669 GGTTGAGGCAGGAAACCCTGAGG - Intronic
1181344238 22:22206407-22206429 GGTTCAGCCAGGAAATGCTCTGG + Intergenic
1183874170 22:40764752-40764774 GGTCCAGGTTGGAAAGCTTCTGG + Intergenic
1184345901 22:43912586-43912608 TGTCCAGGGAGGAGATGCTCTGG - Intergenic
949219747 3:1617559-1617581 GGTCCAGGCAGGAAATAGTGTGG + Intergenic
950358609 3:12433843-12433865 GGTTCAGTCAAAAAATCCTCTGG - Intronic
954422846 3:50427646-50427668 TGGACAGGCAGGAAATCCTGTGG - Intronic
959057666 3:101583985-101584007 AGTCCAGGCAGGTAATGCTAAGG + Intronic
960887432 3:122410370-122410392 GGTCCAGCCAGGAATTTCTAAGG + Exonic
961167479 3:124773615-124773637 GGTCCAGCCAGGCAGCCCTCAGG - Intronic
962481863 3:135804930-135804952 GATCCTGGTAGGAAAACCTCAGG + Intergenic
963064906 3:141255909-141255931 GTTCCAGGCTGGAAAACCTAGGG + Intronic
963340735 3:144029400-144029422 GGTCCAGGCAGTATGCCCTCAGG + Intronic
963797661 3:149647384-149647406 TGCCCAGGCAGGGCATCCTCAGG + Intronic
964292888 3:155201320-155201342 GTTCCAGGCAGGAAAGCAACAGG - Intergenic
966473622 3:180320026-180320048 GTTTCAGGCAGTAAATTCTCTGG + Intergenic
968411091 4:390761-390783 GATCCAGGCAGGAGAGACTCAGG - Intergenic
968893031 4:3381972-3381994 GGTGCTGGCAGGGAAGCCTCTGG - Intronic
969720755 4:8892168-8892190 GGGCCAGCCAGGACATCCCCAGG + Intergenic
969829453 4:9782797-9782819 TCTCCAGGGAGGAAATCCTGCGG - Exonic
970004008 4:11393708-11393730 CCTCCAGGCAGGACAACCTCTGG - Exonic
971257611 4:25029483-25029505 GGTGGAGGCAGGGAATCCCCGGG - Intronic
971324749 4:25634704-25634726 GGACCAGTCAAGAAATCCTAAGG - Intergenic
978860396 4:113442156-113442178 GCTGTAGGCTGGAAATCCTCTGG + Intergenic
981084626 4:140670317-140670339 GGTCCAGGGAAGAATTCCACAGG + Intronic
983939540 4:173525486-173525508 GTTCCAGGATGGAAACCCTCTGG + Intronic
988228066 5:28440400-28440422 GTTGTAGGCAGGTAATCCTCTGG + Intergenic
988744720 5:34123118-34123140 GGTCCAGGCAGAGAACCCACAGG + Intronic
1001451228 5:171826130-171826152 GGTCCAAGCATGAAGTCTTCAGG - Intergenic
1002172573 5:177383731-177383753 GGTCCAGGCAGGAGATGATGAGG - Intronic
1005910525 6:30305560-30305582 GATACAGGCCGGAAATCCTTTGG - Intergenic
1008679745 6:53859484-53859506 GACCCAGTCAGGAAATGCTCAGG - Intronic
1009869305 6:69433957-69433979 GGCCGAGGCAGGAAAACCACCGG + Intergenic
1009935987 6:70234925-70234947 GTTCCAGGCAGGTAATCCTGGGG - Exonic
1013391016 6:109686555-109686577 GGCCCAGGAAGCAAAGCCTCTGG - Intronic
1019807612 7:3139887-3139909 GGTCCAGGCAGCAGTTCCTCTGG + Intergenic
1023940732 7:44767125-44767147 GCTCCAAGCAGAAAATCCTAGGG + Intronic
1028129698 7:87155114-87155136 GTGCCAGGCAGTAAATCCTTAGG - Intronic
1029350527 7:100010028-100010050 TGTTCAGGGATGAAATCCTCAGG - Intergenic
1029493410 7:100884432-100884454 GGAGCAGGCAGGAAAGCCTGGGG + Exonic
1030646756 7:112070155-112070177 GTAGCAGGCAGGAAATCTTCAGG + Intronic
1032021258 7:128408236-128408258 GGTCCAGGCAGGGAACCCCGAGG + Intronic
1033043465 7:137939453-137939475 TGTCAATGAAGGAAATCCTCAGG + Intronic
1034384932 7:150733055-150733077 GTGCCAGCCAGGAAATCTTCAGG + Intronic
1042889219 8:73588621-73588643 GGCAAAGGCAGGAAATTCTCTGG + Intronic
1044717468 8:95113554-95113576 AGTCAATGCAGGAAAGCCTCAGG - Intronic
1048970681 8:139643501-139643523 GGCCCAGGAGGGAAATCTTCAGG - Intronic
1051661559 9:19431676-19431698 GCTCCAGGCAGCTAATCCTCAGG - Intronic
1058205214 9:102097185-102097207 GCTCCAGGCAGTTCATCCTCAGG - Intergenic
1058744495 9:107976698-107976720 GGTCCAGGCAGGAGATGCTGAGG + Intergenic
1061776166 9:132966121-132966143 GGTCAAGGCAGGAGAACCGCTGG + Intronic
1062383055 9:136296832-136296854 AGTCCAGTCAGGTAATCCTGTGG - Intronic
1062585111 9:137245669-137245691 GGTCTTGGCAGGGAACCCTCGGG + Exonic
1186493471 X:9993107-9993129 TGTCCCGGCAGGAAACCCCCCGG - Intergenic
1192049914 X:67715304-67715326 GTTCCAAGCAGGAACTACTCTGG + Intronic
1194497934 X:94640066-94640088 GGTACAGGCAGCACCTCCTCAGG - Intergenic
1197560245 X:128011804-128011826 AGTCCAGGCAGTTAGTCCTCAGG - Intergenic
1201990326 Y:20016715-20016737 TGTCCAGGCAGGAGACACTCAGG + Intergenic