ID: 1094631899

View in Genome Browser
Species Human (GRCh38)
Location 12:32183950-32183972
Sequence CTAGTCCAGCCCGTCACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094631899 Original CRISPR CTAGTCCAGCCCGTCACCAC TGG Intronic
902413373 1:16225259-16225281 CCAGTTCAGCCCTCCACCACTGG - Intergenic
902413388 1:16225316-16225338 CCAGTTCAGCCCCCCACCACTGG - Intergenic
904058509 1:27687852-27687874 CCTGTCCAGCCCACCACCACTGG - Intergenic
904267185 1:29324875-29324897 CTAGCCCCGCCCCTCACCTCTGG + Intronic
907610839 1:55869223-55869245 CTATTGCAGGCTGTCACCACTGG - Intergenic
908789460 1:67767187-67767209 CTTGTCCAGCCTGCCACCACTGG + Intronic
909694759 1:78454406-78454428 CCTGTGCAGCCTGTCACCACTGG + Intronic
910897571 1:92084641-92084663 CTTGTCCAGCCTGCCACCACTGG + Intronic
911041905 1:93597988-93598010 CTATTCCAGCCTGTCAAGACTGG - Intronic
911655431 1:100437571-100437593 CTAGGCAAGTCAGTCACCACAGG - Intronic
916201549 1:162276318-162276340 CTCTTCCAGCCCATCACCATAGG - Intronic
916260232 1:162834546-162834568 CTAGTCCAGCCTGCCACTCCTGG - Intronic
919600644 1:199618184-199618206 CCTGCCCAGCCCATCACCACTGG + Intergenic
922346388 1:224700068-224700090 TTTGTCCAGCCCATCACCGCTGG + Intronic
922795607 1:228338084-228338106 CAAGTCCAGCCCCTCACGGCAGG + Exonic
923135117 1:231110511-231110533 CCTGTGCAGCCCATCACCACTGG - Intergenic
1063365102 10:5485952-5485974 GCAGTCCAGCCCCTCCCCACAGG + Intergenic
1064517696 10:16168623-16168645 CTCGACCAGCCCCACACCACTGG + Intergenic
1069515082 10:69070872-69070894 CTATTCCAGCCCTTCCCCTCTGG + Intergenic
1071666575 10:87564311-87564333 CAAGCCCAGCCCACCACCACTGG + Intergenic
1073095601 10:100977866-100977888 CCAGTGCAGCCCGCCGCCACTGG - Intronic
1074164607 10:110864019-110864041 CTTGTCCAGCCCACCATCACTGG - Intergenic
1074283765 10:112079067-112079089 CCTGTCCAGCCCGCCACCACTGG + Intergenic
1074696628 10:116055698-116055720 CTAGTCCTGCCCCTCCCCACGGG + Intergenic
1077107207 11:847433-847455 AAAGTCCAGCCCCTCCCCACGGG - Intronic
1077646746 11:3932099-3932121 CTTGTTCAGCCCGCCACTACTGG + Intronic
1077646752 11:3932148-3932170 CTTGTCCAGCCCACCACCACTGG + Intronic
1079317929 11:19425537-19425559 CTAGTCCAGACTGTAACCACTGG - Intronic
1079658773 11:23015846-23015868 CCTGCCCAGCCCGCCACCACTGG - Intergenic
1083653956 11:64220128-64220150 CTAGCCCACACCGTCACCTCAGG - Intronic
1084556523 11:69879296-69879318 CTGGCCCAGCCAGTCTCCACAGG - Intergenic
1085211032 11:74778610-74778632 CCCGCCCAGCCCGCCACCACTGG - Intronic
1086448301 11:86890802-86890824 GTTGTCCAGCCCACCACCACTGG + Intronic
1089083856 11:115800326-115800348 CCTGTCCAGCCTGCCACCACTGG + Intergenic
1090866401 11:130704606-130704628 CTAGTCCTGCAGGTCAGCACAGG + Intronic
1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG + Intronic
1092969467 12:13678260-13678282 CCTGTCCAGCCCACCACCACTGG + Intronic
1093497541 12:19775488-19775510 CCATTCCTGCCCGGCACCACAGG - Intergenic
1094631899 12:32183950-32183972 CTAGTCCAGCCCGTCACCACTGG + Intronic
1098586860 12:72164535-72164557 CTTGTCCAGCCTGCCACCACAGG - Intronic
1105203150 13:18195637-18195659 CCAGTCCAGCGCTTCACCGCCGG - Intergenic
1106797166 13:33218403-33218425 CCTGTCCAGCCTGCCACCACTGG + Intronic
1106837822 13:33654987-33655009 CTAGTCCCGTCCCTCACCCCTGG + Intergenic
1106938233 13:34747686-34747708 CCATTCCTGCCCGGCACCACAGG - Intergenic
1107716187 13:43201832-43201854 TCTGTCCAGCCCGTCAACACTGG - Intergenic
1113769340 13:112898470-112898492 CAGGTCCAGCCTTTCACCACTGG + Intronic
1116273277 14:42799707-42799729 CTTGTCTAGCCTGCCACCACTGG - Intergenic
1116638999 14:47436776-47436798 CTTGTCCAACCCGTGGCCACTGG - Intronic
1120827878 14:88971531-88971553 TTTGTCCAGCCCGTGACCAGGGG + Intergenic
1126704577 15:51395543-51395565 CCTGTCCAGCCTGCCACCACTGG - Intronic
1127915379 15:63450833-63450855 CCTGTCCAGCCTGCCACCACTGG - Intergenic
1130667809 15:85884699-85884721 CTTGTCCAGCCCGCTGCCACTGG + Intergenic
1130758773 15:86795533-86795555 CTCATCCAGCCCCTCAGCACAGG + Intronic
1131510431 15:93046852-93046874 TCAGTCCAGCCCCTCACCCCTGG - Intronic
1133444454 16:5848221-5848243 CTTATCCAGCCCACCACCACTGG + Intergenic
1134434871 16:14247241-14247263 GTAGGCCAGCCCGTCTCTACAGG + Exonic
1138838955 16:60474362-60474384 CGTGTCTAGCCCATCACCACTGG + Intergenic
1138838963 16:60474411-60474433 CCTGTCCAGCCTGTCACCACTGG + Intergenic
1139504385 16:67391823-67391845 CCAGCCCAGCCCCTCAGCACTGG - Exonic
1143427810 17:6854005-6854027 CTATTCCTGCCTGGCACCACTGG + Intergenic
1143891725 17:10107450-10107472 CCTGCCCAGCCCGCCACCACTGG - Intronic
1143891734 17:10107493-10107515 CCTGCCCAGCCCGCCACCACTGG - Intronic
1146271851 17:31489904-31489926 CTAGTCCCGCCCCTCGCCTCCGG - Intronic
1146557846 17:33842032-33842054 GTTGTCCAGCCTGCCACCACTGG - Intronic
1146557853 17:33842075-33842097 GTCGTCCAGCCCACCACCACTGG - Intronic
1149910663 17:60564127-60564149 CCTGTCCAGCCTGCCACCACTGG - Intergenic
1150281009 17:63929644-63929666 TTGGTCCAGCCTGTCCCCACTGG - Intronic
1152646547 17:81471511-81471533 CTAGACCATTCCGTCACCGCAGG - Intergenic
1152741031 17:82018411-82018433 CTGGTCCTGCCTGTGACCACAGG + Intergenic
1154354359 18:13613743-13613765 CTAGTCCGTCCAGTCATCACGGG + Intronic
1156754679 18:40508026-40508048 CTTGTCCAGAACGTCATCACTGG + Intergenic
1161618833 19:5287584-5287606 CGGGTCCAGGCCGTGACCACAGG + Intronic
1167403007 19:49285466-49285488 CCTGTCCAGCTCATCACCACTGG + Intergenic
926311857 2:11681045-11681067 GCAGTCCAGCCTGTCACCACAGG - Intronic
927018669 2:18995332-18995354 CCTGTCCAGCCTGCCACCACTGG - Intergenic
927252988 2:21015294-21015316 CTAGTTCAGCCTGTAACCACAGG + Intronic
928699495 2:33884389-33884411 CTTGTCCAGCCTGCCGCCACTGG + Intergenic
930314846 2:49785283-49785305 CTTGTCCAGTCTGCCACCACTGG - Intergenic
930314852 2:49785326-49785348 CTCATCCAGCCCACCACCACTGG - Intergenic
931998703 2:67863805-67863827 CTTGTCCAGCCTGCCACCACTGG + Intergenic
933266892 2:80190305-80190327 CTGGTCCAGCCTGCCACCACTGG - Intronic
939522436 2:143247370-143247392 CCTGTCCAGCCTGGCACCACTGG + Intronic
940316269 2:152330790-152330812 CCTGTCCAGCCCACCACCACTGG + Intergenic
940724603 2:157322160-157322182 CTTGTCTAGCCAGTCACAACTGG + Intronic
941425162 2:165334459-165334481 CTGGTCCAGCCCTGCATCACTGG - Intronic
941690319 2:168494716-168494738 CCTGTCCAGCCTGCCACCACTGG - Intronic
943029580 2:182670093-182670115 CTTGTCCAGCCCACCACCACTGG + Intergenic
945969231 2:216220070-216220092 GTTGTCCAGCCCAACACCACAGG + Intergenic
946709047 2:222487734-222487756 GTTGTCCAGCCTGCCACCACTGG - Intronic
948261325 2:236606403-236606425 CTAGCCCAGCCCATCCCCAGGGG + Intergenic
1169641848 20:7761012-7761034 CTTGTCCAGCCCACCACCACTGG + Intergenic
1175332651 20:58175912-58175934 CTTGTCCATCCCGTCACCCAGGG - Intergenic
1175532029 20:59680345-59680367 CCTGTCCAGCCTGCCACCACTGG - Intronic
1175532037 20:59680395-59680417 GTTGTCCAGCCTGCCACCACTGG - Intronic
1176714809 21:10342368-10342390 CCAGTCCAGCGCTTCACCGCCGG + Intergenic
1178059284 21:28834526-28834548 CCATTCCTGCCTGTCACCACAGG + Intergenic
1180785317 22:18543860-18543882 CTAGCGCAGCCAGGCACCACTGG + Intergenic
1181128899 22:20717901-20717923 CTAGCGCAGCCAGGCACCACTGG + Intronic
1181242219 22:21483213-21483235 CTAGCGCAGCCAGGCACCACTGG + Intergenic
1181479305 22:23188001-23188023 CCAGTCCAGCCCATCACCCAAGG - Intronic
1181486221 22:23233337-23233359 CGAGAACAGCCTGTCACCACCGG - Intronic
1182930262 22:34167016-34167038 CCTGTCCAGCCTGCCACCACTGG - Intergenic
1182930283 22:34167149-34167171 GTTGTCCAGCCTGCCACCACTGG - Intergenic
1182930310 22:34167319-34167341 ATTGTCCAGCCCGCCACCACTGG - Intergenic
1182930321 22:34167404-34167426 GTTGTCCAGCCCATCACTACTGG - Intergenic
1185083984 22:48726468-48726490 CCTGTCCAGCCCACCACCACTGG - Intronic
1185083996 22:48726552-48726574 CCTGTCCAGCCCACCACCACTGG - Intronic
1185084010 22:48726636-48726658 CCTGTCCAGCCCACCACCACTGG - Intronic
1185084022 22:48726720-48726742 CCTGTCCAGCCCACCACCACTGG - Intronic
949279746 3:2331949-2331971 CCTGTCCAGCCCAACACCACTGG + Intronic
950777766 3:15365183-15365205 CCTGTCCAGCCCACCACCACTGG - Intergenic
955442770 3:58974833-58974855 GTTATCCAGCCCGCCACCACTGG + Intronic
955442778 3:58974882-58974904 CCTGTCCAGCCCACCACCACTGG + Intronic
956426357 3:69139708-69139730 CCTGTCCAGCCCACCACCACTGG + Intergenic
957943648 3:87036564-87036586 CTTGTCCAGCCCATCTCCACTGG - Intergenic
959668184 3:108944551-108944573 CCTGCCCAGCCCGCCACCACTGG + Intronic
963909422 3:150802820-150802842 CTTGCCCATCCTGTCACCACTGG - Intergenic
970864978 4:20747812-20747834 GTCATCCAGCCAGTCACCACAGG - Intronic
973017984 4:45165574-45165596 CTCGTCCAGCTCCCCACCACTGG + Intergenic
974101613 4:57423192-57423214 CTAGTCCAGCCCTTGACCCAAGG - Intergenic
975219990 4:71803962-71803984 CTAGTCCAGATCATCACCAGTGG + Exonic
975719235 4:77234152-77234174 CTTGTCCAGCCCACCGCCACTGG + Intronic
976551948 4:86406747-86406769 CCTGTCCAGCCTGTCACCACTGG - Intronic
978557315 4:109994736-109994758 CTACTCCACCCCCTCACCTCAGG + Exonic
979635154 4:122948681-122948703 CCTGTCCAGCCCATCACCACTGG - Intronic
982170391 4:152656000-152656022 CCAGTCTAGTCCATCACCACTGG + Intronic
984040453 4:174726430-174726452 CTACTCCAGCCCAACACCACAGG - Intronic
985843448 5:2326917-2326939 CTAGTCCAACCTGACAACACAGG - Intergenic
985907255 5:2849517-2849539 GAAATCCAGCCCGCCACCACTGG - Intergenic
986616053 5:9618623-9618645 CTAGTCCAGTCCCTCATCCCAGG + Intergenic
986659111 5:10043156-10043178 CCTGCCCAGCCCGCCACCACTGG + Intergenic
991597116 5:68317090-68317112 CTTATCCAGCCCACCACCACTGG + Intergenic
996700994 5:126450200-126450222 GTAGTACAGCTCGTCTCCACGGG + Intronic
997890633 5:137673281-137673303 CCTGTCCAGCCTGCCACCACTGG + Intronic
999108330 5:149093511-149093533 TTAGTCCAGTCCATCACCATTGG + Intergenic
999440947 5:151600259-151600281 CCAGTCCAGCCTGCCACCCCAGG + Intergenic
1006584002 6:35093804-35093826 CTACTCCAGCCAAGCACCACAGG + Intergenic
1008490539 6:52082392-52082414 CTGGTCCGGCATGTCACCACAGG + Exonic
1011371695 6:86643623-86643645 CTAGTCCATCCTGACACCAATGG - Intergenic
1011733804 6:90293556-90293578 CTAGGCCAGCCCTTCACTTCTGG - Intronic
1013189486 6:107790052-107790074 CTAGTCCAGCCTTTCAGCACTGG + Intronic
1017895938 6:158679963-158679985 ATGCTCCAGCCCGTTACCACTGG - Intronic
1019652061 7:2165286-2165308 CCAGTCCAGCCCTTCATCCCCGG - Intronic
1021611899 7:22465800-22465822 CTCATCCAGCCTGTCAGCACTGG - Intronic
1021612982 7:22475919-22475941 CCTGTCCAGCCCACCACCACTGG + Intronic
1022060982 7:26794744-26794766 CTTGTCCAGCCCACCACCACTGG + Intronic
1022060996 7:26794827-26794849 CTTGTCCAGCCCACCACCACTGG + Intronic
1022061005 7:26794870-26794892 CTTGTCCAGCCAGCCACCACTGG + Intronic
1022947386 7:35301006-35301028 CCTGTCCAGCCCGGCACCACTGG + Intergenic
1024176438 7:46845380-46845402 GTTGTCCAGCCCACCACCACTGG + Intergenic
1024706046 7:51960927-51960949 CAAATCCAGCCCTTCCCCACAGG - Intergenic
1033871468 7:145759154-145759176 CCAGACAAGCCAGTCACCACAGG - Intergenic
1039123487 8:34175213-34175235 CCATTCCAGCCTGGCACCACAGG + Intergenic
1039133543 8:34294795-34294817 CCTGTCCAGCCCACCACCACTGG + Intergenic
1041227680 8:55716724-55716746 CCAGTCCTGCCTGGCACCACAGG + Intronic
1044738357 8:95301513-95301535 ATTGTCCAGCCCACCACCACTGG - Intergenic
1046754963 8:117963336-117963358 CCTGTCCAGCCAGCCACCACTGG + Intronic
1047361359 8:124172174-124172196 CTTGTCCAGCCCGGTGCCACTGG + Intergenic
1047488758 8:125356894-125356916 CTAGCCCAGCGTCTCACCACTGG + Intronic
1048330454 8:133467295-133467317 CCAGGCCCGCCCGTCACCTCAGG + Intronic
1049290659 8:141799956-141799978 CTGGTCCAGCCCTCCACCAGCGG - Intergenic
1049794778 8:144492120-144492142 CTGGGCCAGCCCGTCACTGCCGG + Intronic
1051669432 9:19494971-19494993 CTTGTCCAGCACACCACCACTGG - Intergenic
1052871491 9:33511686-33511708 CCAGGCCAGCCCACCACCACTGG - Intergenic
1054827006 9:69583265-69583287 CTAGTCCAGCCCACCACCACTGG + Intronic
1055755499 9:79553574-79553596 CCTGTCCAGCCCATCACCACTGG + Intergenic
1056556504 9:87694331-87694353 CTAGCCCAGTCCACCACCACTGG - Intronic
1057686112 9:97236269-97236291 CCAGGCCAGCCCACCACCACTGG + Intergenic
1060453991 9:123772790-123772812 CCAGTCCACCATGTCACCACTGG + Intronic
1062508375 9:136890221-136890243 CTCGTTCAGCTGGTCACCACGGG + Intronic
1187174403 X:16883013-16883035 CTAGTCCTCCCAGTCCCCACAGG + Intergenic
1188672261 X:32894398-32894420 CTTGTCCAGTCTGCCACCACTGG - Intronic
1189377253 X:40475553-40475575 CCTGTCCAGCCCGCCATCACTGG + Intergenic
1190412971 X:50155424-50155446 CAAGTCCAGCTCGTCATCACAGG + Intergenic
1190895564 X:54614537-54614559 CTATTCCTGCCTGGCACCACAGG - Intergenic
1193154505 X:78158443-78158465 CTATTCCTGCCTGACACCACAGG + Intergenic
1195039593 X:101002017-101002039 TCCGTCCAGCCCATCACCACTGG - Intergenic
1198758511 X:140006249-140006271 CCTGCCCAGCCCGCCACCACTGG + Intergenic
1198780246 X:140227343-140227365 CCTGCCCAGCCCGCCACCACTGG - Intergenic