ID: 1094633742

View in Genome Browser
Species Human (GRCh38)
Location 12:32203588-32203610
Sequence GGCCCATTTCGGATTAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 42}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094633731_1094633742 20 Left 1094633731 12:32203545-32203567 CCCGGAGACTGATTCCTTGTCTA 0: 1
1: 1
2: 15
3: 68
4: 218
Right 1094633742 12:32203588-32203610 GGCCCATTTCGGATTAAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 42
1094633734_1094633742 6 Left 1094633734 12:32203559-32203581 CCTTGTCTATGAGGAACATCTGA 0: 23
1: 87
2: 106
3: 114
4: 189
Right 1094633742 12:32203588-32203610 GGCCCATTTCGGATTAAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 42
1094633732_1094633742 19 Left 1094633732 12:32203546-32203568 CCGGAGACTGATTCCTTGTCTAT 0: 1
1: 1
2: 18
3: 61
4: 243
Right 1094633742 12:32203588-32203610 GGCCCATTTCGGATTAAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 42
1094633730_1094633742 24 Left 1094633730 12:32203541-32203563 CCAACCCGGAGACTGATTCCTTG 0: 1
1: 0
2: 5
3: 50
4: 181
Right 1094633742 12:32203588-32203610 GGCCCATTTCGGATTAAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094633742 Original CRISPR GGCCCATTTCGGATTAAAGG AGG Intronic
901640863 1:10692403-10692425 GCCCCATTTCCGAAGAAAGGGGG + Intronic
915942058 1:160124496-160124518 GGCCCAGTGAGGTTTAAAGGTGG + Intronic
1062981085 10:1723677-1723699 TGCCCATTTCTCATTAAAGATGG - Intronic
1066680133 10:37930158-37930180 GGCCCATTTCAAAGCAAAGGAGG - Intergenic
1069584124 10:69585913-69585935 GGCCCATTTCACAGTAAAGGAGG + Intergenic
1084902959 11:72323674-72323696 GGACCATTCCAGATTAAAGAAGG + Intronic
1090200142 11:124848235-124848257 GCCCCATTTCTGATTACAGGAGG + Intergenic
1093807553 12:23452965-23452987 GGCCCATATCGGACTAATGAGGG - Intergenic
1094301763 12:28972328-28972350 TGGCCATTTCTGATTAAAGTTGG - Intergenic
1094633742 12:32203588-32203610 GGCCCATTTCGGATTAAAGGAGG + Intronic
1096776116 12:53965436-53965458 GGCCAATTTAGGATCAAAAGAGG - Intergenic
1108527353 13:51297104-51297126 TACCCACTTTGGATTAAAGGGGG + Intergenic
1110339277 13:74370147-74370169 GGCCCAGATAGGACTAAAGGAGG + Intergenic
1111054938 13:82937419-82937441 GGCCCATCTCTGACTAAAGGAGG + Intergenic
1112435166 13:99386714-99386736 GGCGCAATTCAGATTCAAGGAGG - Intergenic
1115353544 14:32423127-32423149 GGGCAATTTCTGATTAAAGATGG - Intronic
1119609454 14:76049364-76049386 GGCCTATTTTGTATTAAAAGGGG - Intronic
1132024569 15:98394087-98394109 GGGCCATTTCTTTTTAAAGGAGG - Intergenic
1133563452 16:6970765-6970787 GACCCAATTCAGGTTAAAGGGGG - Intronic
1135976810 16:27113785-27113807 GGCCCATTTAGGACTGAAGATGG + Intergenic
1136267764 16:29131185-29131207 GGCCCATTTCCCATGACAGGCGG - Intergenic
1142071070 16:88091533-88091555 GGCCCATTTCCCATGACAGGCGG - Intronic
1147413787 17:40273804-40273826 GCACCATTTCGGATCACAGGTGG - Exonic
1154149312 18:11893733-11893755 AGTCCATATCTGATTAAAGGTGG + Intronic
1158433574 18:57416053-57416075 GGCCCATTCCAGATTCAAGGAGG - Intergenic
938508366 2:131911435-131911457 GGGGCATTACTGATTAAAGGTGG + Intergenic
940232313 2:151469407-151469429 AGTCCATTTCTGATTAAAGTTGG + Intronic
1174315694 20:49699346-49699368 TGCCCATTTAGGATTCAAGATGG - Intronic
1175530563 20:59671971-59671993 GCCACATTTCAGAATAAAGGAGG - Intronic
1176785126 21:13247128-13247150 GGGGCATTACTGATTAAAGGTGG - Intergenic
1183956582 22:41383825-41383847 GGGTCATTTGGGATCAAAGGAGG - Intronic
949673076 3:6422944-6422966 GACCCATTTAGGATTATTGGGGG + Intergenic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
957336859 3:78841345-78841367 GGACCATTTGGGCTTAAAGGAGG + Intronic
970775282 4:19667473-19667495 GGCCTTTTTCTAATTAAAGGCGG + Intergenic
971789577 4:31151498-31151520 TGCCCACTTGGGATTAGAGGTGG + Intergenic
976269031 4:83212127-83212149 GGCAGAGTTCGGATTAAATGTGG + Intergenic
993198739 5:84784287-84784309 GGATCATTTCTGATTAAAAGTGG - Intergenic
1001204321 5:169747841-169747863 GACCCTTTTGGGATTAAAGAGGG + Intronic
1015795752 6:137009481-137009503 GGCCAATTTGTGCTTAAAGGGGG + Exonic
1024732899 7:52273038-52273060 GACCCATTTAGGATTAAATGAGG + Intergenic
1027795793 7:82691602-82691624 GGCTGATTTTGGATTGAAGGTGG + Intergenic
1033582135 7:142748017-142748039 GGCCCATTAGTGATTAGAGGGGG + Intergenic
1038522006 8:28241981-28242003 GGTTCATTACGTATTAAAGGTGG + Intergenic
1041143419 8:54846074-54846096 GGCCCATTTCTGATTACACAAGG - Intergenic
1052010514 9:23403004-23403026 GGCCCATTGCCAATTAAAAGAGG + Intergenic
1195865297 X:109426318-109426340 GGCACAGTTGGGATAAAAGGAGG + Intronic
1199765414 X:150937668-150937690 GGACCATTTGTGATTACAGGGGG + Intergenic
1200879357 Y:8196166-8196188 GGTCAATTTCGGAATAAATGTGG - Intergenic