ID: 1094636046

View in Genome Browser
Species Human (GRCh38)
Location 12:32227740-32227762
Sequence GAGTACCCGTAGCCTCCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094636041_1094636046 25 Left 1094636041 12:32227692-32227714 CCATTGGCAACTGGCAGAGGAAA 0: 1
1: 0
2: 2
3: 37
4: 620
Right 1094636046 12:32227740-32227762 GAGTACCCGTAGCCTCCATTGGG 0: 1
1: 0
2: 0
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094636046 Original CRISPR GAGTACCCGTAGCCTCCATT GGG Intronic
900833072 1:4978943-4978965 GAGTCTCCGTGGCCTCCACTTGG + Intergenic
903856890 1:26343061-26343083 GGGCCCCCGTAGCCTCCATAAGG - Exonic
906611989 1:47209849-47209871 CAGTACCCGTACCCTACATCAGG - Intergenic
908184181 1:61636037-61636059 CAGTACCCGTAGGCTCCTCTTGG + Intergenic
908447671 1:64216337-64216359 GAATACCAGTAGGCTCCACTTGG + Intronic
909501201 1:76337471-76337493 GTGTACCAGTGTCCTCCATTCGG + Intronic
921909249 1:220528876-220528898 GAGTAACCGGAGCCTCCCTCGGG + Intronic
1085689137 11:78651379-78651401 GAGGAGGCGTGGCCTCCATTCGG + Intergenic
1086757869 11:90587702-90587724 TTGTGCCAGTAGCCTCCATTAGG - Intergenic
1091041780 11:132287831-132287853 GTGTACCCATATCCTGCATTTGG - Intronic
1094636046 12:32227740-32227762 GAGTACCCGTAGCCTCCATTGGG + Intronic
1140646553 16:77037948-77037970 GAGTTCCCCTAGGCCCCATTTGG + Intergenic
1145274698 17:21422531-21422553 GAGTACCCAGAGCCTTCCTTGGG - Intergenic
1145312550 17:21708429-21708451 GAGTACCCAGAGCCTTCCTTGGG - Intergenic
1151612124 17:75183010-75183032 GAGTAGCCGAAGCCTCCCATTGG + Intergenic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1154025209 18:10700910-10700932 AAGTACCCAAACCCTCCATTTGG - Intronic
1165004275 19:32791852-32791874 GAGTCCCCAGAGCCTCCAGTTGG + Intronic
927074792 2:19566994-19567016 GAGAACCAGATGCCTCCATTCGG + Intergenic
930806606 2:55496770-55496792 GAGTACCTGTAGACTCCCTGTGG + Intergenic
1170725333 20:18921049-18921071 GAGGGCCCGTAGCCTCCAAGAGG + Intergenic
1175332793 20:58176506-58176528 GCGTAACAGCAGCCTCCATTTGG - Intergenic
950493137 3:13318292-13318314 GAGCACCCGTGGCCTCCCCTGGG + Intronic
977721271 4:100242915-100242937 TACTAACTGTAGCCTCCATTAGG - Intergenic
978847194 4:113287749-113287771 GATTCCCAGTAGCCCCCATTCGG + Intronic
1032391242 7:131556623-131556645 GAGTAGCCGCAGCCGCCAGTGGG - Intronic
1048702330 8:137106215-137106237 GACTACCCTTGGCCACCATTAGG + Intergenic
1186812331 X:13202473-13202495 GAGAAACCTTAGCCTCCATGAGG + Intergenic
1189141976 X:38616663-38616685 GAGTACCCGTTGCCTGCTATAGG + Intronic