ID: 1094637659

View in Genome Browser
Species Human (GRCh38)
Location 12:32242171-32242193
Sequence CCTAGGCTGGAGCGCAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11241
Summary {0: 1, 1: 10, 2: 350, 3: 6709, 4: 4171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094637659_1094637665 29 Left 1094637659 12:32242171-32242193 CCATCACTGCGCTCCAGCCTAGG 0: 1
1: 10
2: 350
3: 6709
4: 4171
Right 1094637665 12:32242223-32242245 AAAAAAAAAAAAAAAAAAAAAGG 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094637659 Original CRISPR CCTAGGCTGGAGCGCAGTGA TGG (reversed) Intronic
Too many off-targets to display for this crispr