ID: 1094642989

View in Genome Browser
Species Human (GRCh38)
Location 12:32294684-32294706
Sequence AGTGAGAGACCAGTGATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 1, 3: 73, 4: 302}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094642989_1094642994 21 Left 1094642989 12:32294684-32294706 CCTACAATCACTGGTCTCTCACT 0: 1
1: 0
2: 1
3: 73
4: 302
Right 1094642994 12:32294728-32294750 ATTGCTTTCAAATCGTAGAGGGG 0: 1
1: 0
2: 0
3: 9
4: 115
1094642989_1094642995 26 Left 1094642989 12:32294684-32294706 CCTACAATCACTGGTCTCTCACT 0: 1
1: 0
2: 1
3: 73
4: 302
Right 1094642995 12:32294733-32294755 TTTCAAATCGTAGAGGGGAATGG 0: 1
1: 0
2: 0
3: 9
4: 152
1094642989_1094642993 20 Left 1094642989 12:32294684-32294706 CCTACAATCACTGGTCTCTCACT 0: 1
1: 0
2: 1
3: 73
4: 302
Right 1094642993 12:32294727-32294749 AATTGCTTTCAAATCGTAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 121
1094642989_1094642992 19 Left 1094642989 12:32294684-32294706 CCTACAATCACTGGTCTCTCACT 0: 1
1: 0
2: 1
3: 73
4: 302
Right 1094642992 12:32294726-32294748 AAATTGCTTTCAAATCGTAGAGG 0: 1
1: 0
2: 1
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094642989 Original CRISPR AGTGAGAGACCAGTGATTGT AGG (reversed) Intronic
900846424 1:5105925-5105947 TGTGAGAGACCACAGAATGTGGG + Intergenic
901531802 1:9858381-9858403 AGTCAGAGACCAGCGTGTGTGGG - Intronic
901623602 1:10609546-10609568 AGTGACAGAGCAGAGATTGGTGG - Intronic
901833263 1:11906962-11906984 AGTGAGAGAACAGGGGTAGTGGG + Intergenic
902932983 1:19744490-19744512 AGTGAGAGATCAGTATGTGTTGG - Intronic
903900405 1:26640598-26640620 AGCGAGATGCCAGTGGTTGTGGG - Intergenic
903901265 1:26647440-26647462 AGCGAGATGCCAGTGGTTGTGGG + Intergenic
904116969 1:28170038-28170060 AGTGAGAGCTCATTGAATGTTGG + Intronic
904270432 1:29346387-29346409 AGTGAGGGATCACTGACTGTGGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
909109258 1:71453980-71454002 AGTTAGACACCAGTGTTTGTGGG - Intronic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910163809 1:84301313-84301335 AGTGAGAAGCCAGTGCTTATGGG - Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910739400 1:90498348-90498370 AGAGAGAGACCACTAAGTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911012600 1:93297057-93297079 AGTAAGAGCGCAGTGATTTTGGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
914243265 1:145866999-145867021 AGTGAAAGATGAGTGATGGTAGG - Intronic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915087440 1:153397992-153398014 AGTGAGGGGGAAGTGATTGTTGG - Intergenic
915374955 1:155386001-155386023 AGGGAGAGACATATGATTGTTGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916678790 1:167086182-167086204 AGTCAGAAGCCAGTGCTTGTAGG - Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
920983493 1:210861852-210861874 AGTGTGATAACAGTGCTTGTTGG - Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
921982847 1:221276814-221276836 AGTGTGAGTCCCATGATTGTAGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
923526538 1:234777116-234777138 AGGGAGAGGCCAGTGAAGGTCGG + Intergenic
923575486 1:235154909-235154931 AATGAGAGAACTGTGTTTGTTGG - Exonic
923734286 1:236588328-236588350 AGTGAGAGCCCAGATATTGACGG + Intronic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1070571260 10:77640570-77640592 GGTGAGAGACTGGGGATTGTAGG - Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1073428275 10:103469607-103469629 AATGAGAGACAAGTGCTTGGTGG - Intergenic
1074164605 10:110864010-110864032 AGACAGAGTCCAGTGATGGTGGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1077136166 11:1000266-1000288 AGTGAGTGACCAGAGAGTGAGGG - Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1082976772 11:59080445-59080467 TGTGAGAGACCTGTGATTCTAGG - Intergenic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1083891138 11:65596329-65596351 AGTAAGAGGCCAGTGAAGGTAGG + Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1088739357 11:112754286-112754308 ATTGAGAGATCTCTGATTGTGGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1100031806 12:90201780-90201802 AGTGAGAGACCAGTGCTGTGAGG + Intergenic
1100904808 12:99285756-99285778 AGGAAGAGAGCAGTAATTGTGGG + Intronic
1100964923 12:100002109-100002131 AGTAATAGACCAGGAATTGTGGG - Intergenic
1101699359 12:107157463-107157485 AGAGAGAGAAGAGTGATTCTTGG + Intergenic
1104230678 12:126880991-126881013 AGGGAAAGACCAGGGATTGGTGG - Intergenic
1107216619 13:37928262-37928284 ATTGAGACACAAGTAATTGTAGG + Intergenic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108270298 13:48752709-48752731 AGAGAGAGAAATGTGATTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112969842 13:105247366-105247388 TGGAAGAGACCAGTGAATGTAGG + Intergenic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1115067957 14:29288221-29288243 GGTGAGAGACCAAAGCTTGTTGG - Intergenic
1116037882 14:39650141-39650163 ATTGAGAGATCAGTTATTTTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119753000 14:77093779-77093801 AGGCAGAGGCCAGTGATAGTGGG - Intergenic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1123216254 14:106812206-106812228 AGAGAGAGACAAGTTTTTGTAGG + Intergenic
1125517070 15:40327406-40327428 AGTGAGAAGCCAGTGTTGGTGGG + Intergenic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1128292962 15:66492772-66492794 ACTGAGATACCAATGATAGTTGG + Intronic
1130155064 15:81343447-81343469 ACTTAGAGATCAGTGCTTGTGGG + Intronic
1132311099 15:100858567-100858589 AGTGAGAGCTCAGTGACTGAAGG - Intergenic
1132929463 16:2451480-2451502 AGTGGGAGACCAGGGAGTGGGGG - Intronic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1136248650 16:28989589-28989611 GGTGAGTGACCGGTGCTTGTCGG + Exonic
1136873137 16:33825871-33825893 AGAGAGAGACAAGTTCTTGTAGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140711851 16:77686022-77686044 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1203099035 16_KI270728v1_random:1290184-1290206 AGAGAGAGACAAGTTCTTGTAGG + Intergenic
1143157746 17:4849241-4849263 AGTGACTGCCCAGTGATTGCCGG - Intronic
1143164540 17:4891429-4891451 AGGGAGAGACCAGGGAGGGTGGG - Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144021874 17:11245105-11245127 AGTGAGAAATCAGTGTCTGTGGG + Intronic
1145112954 17:20180614-20180636 GGTGAGAGACCAGGGATGGTGGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145778963 17:27549497-27549519 AGCCAGAGCCCAGTGTTTGTCGG + Intronic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1148102719 17:45102523-45102545 AGAGAAAGAGCAGTGAGTGTGGG + Intronic
1148155704 17:45424358-45424380 AGTGAGAGGTCAGTGGCTGTTGG - Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149649296 17:58266930-58266952 AGAGAGAAACCAATGACTGTTGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151396845 17:73828375-73828397 AGTGAGACAGCAGTGAGTCTAGG - Intergenic
1151711378 17:75808954-75808976 GGAGAGAGACCAGTGAAGGTTGG + Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1157169924 18:45393802-45393824 AGTGAGAACTCAGTGAGTGTTGG - Intronic
1157375029 18:47154749-47154771 AGTTAGAGATCAGTGATCTTTGG - Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159758991 18:72401471-72401493 AGTGACAGAGCAGAGATTGGAGG - Intergenic
1160825143 19:1076453-1076475 AGGTAGAAACCTGTGATTGTTGG + Intronic
1161728292 19:5943536-5943558 AGTGAGAGCCCAGAGAAGGTAGG + Intronic
1166572519 19:43806693-43806715 AGTGAGAGCCCTGAGCTTGTTGG - Intronic
1168604363 19:57746850-57746872 AGTGAGAGACCGCGGAGTGTTGG + Exonic
925338138 2:3113851-3113873 AGCAAGAGAACAGTGGTTGTGGG + Intergenic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927330692 2:21859890-21859912 AGCCAGAGACCAGACATTGTAGG + Intergenic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
929531228 2:42754324-42754346 AGTGAGAGAACTGTGTTTGTGGG + Exonic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
932404079 2:71502446-71502468 AGTGAGTGGCCTGTGACTGTAGG - Intronic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
933255214 2:80072802-80072824 ACTGAGAAACCTGTGATGGTAGG + Intronic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935703885 2:105839465-105839487 AGTGAGAGACAAGAGCTTGAGGG + Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937164184 2:119795832-119795854 AGTGAGGGAGCAGTGATGTTAGG - Intronic
938120102 2:128627069-128627091 AAGAAGAGACCAGTGATTCTTGG - Intergenic
939782702 2:146468697-146468719 AGTGAGAGAAGAGTGAGTTTGGG - Intergenic
940191328 2:151043103-151043125 AGTGAGACTACAGTTATTGTGGG - Intronic
940338855 2:152558240-152558262 AATGAGAGACCACTGTTTATGGG - Intronic
940468568 2:154064074-154064096 ATGGAGAGGCCAGTGATTATAGG + Intronic
940597019 2:155807314-155807336 AGTGAGAGACTAGTAATGGTAGG - Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
946340677 2:219065824-219065846 AATCAGAGACCAAAGATTGTGGG + Intergenic
946714383 2:222538127-222538149 ATGGAGAGACCAGTGGTTGCTGG + Intronic
946729128 2:222691503-222691525 TGTCAGAAACCAGTGATTGCTGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948726308 2:239936145-239936167 AGAGAGTGAACAGTGACTGTTGG + Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168906125 20:1405182-1405204 AGAGAGAGTCCAGTGGTGGTGGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170142006 20:13133775-13133797 AGGGATGGTCCAGTGATTGTAGG + Intronic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174564068 20:51452201-51452223 CCTGAGAGTCCAGTGATTGGGGG - Intronic
1175206160 20:57313118-57313140 ACTGGAAGCCCAGTGATTGTAGG + Intergenic
1175327054 20:58137212-58137234 AGTGAGAGAACGGGGGTTGTTGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178170739 21:30036907-30036929 AGTGTAAGAACAGTGATGGTTGG - Intergenic
1181089070 22:20459733-20459755 AGTGGGAGACCTGGGAATGTTGG - Intronic
1181684449 22:24518928-24518950 AGTGAGAGCCCAGTGTGTGCAGG - Intronic
1181687269 22:24538031-24538053 AGTGAGGGACCAGGGATTGTGGG + Intergenic
949185041 3:1180004-1180026 AGTCAGAGAGCTGTGATTGCAGG - Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952026482 3:29088480-29088502 TGTGAGAGAACAGTGTTTGATGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
953753868 3:45630421-45630443 AGTGAGAGGGAAGTGTTTGTGGG + Intronic
954724626 3:52597101-52597123 AGTTAGAGCACAGTGATTGAGGG - Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958065268 3:88536739-88536761 AGTTAGAGACTAGAGATAGTGGG - Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959259216 3:104053274-104053296 AGTGAAAGCCCAGTAGTTGTGGG + Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
961199453 3:125032718-125032740 AGACAGAGAGAAGTGATTGTAGG + Intronic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963194965 3:142516780-142516802 TGTGAGAGAGAAGTGATAGTTGG - Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964386171 3:156150330-156150352 AGTGAGAGACGAGTGCTGCTTGG + Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965014673 3:163141148-163141170 AGAGAGAGAGCAGTTATTATTGG - Intergenic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965806435 3:172547158-172547180 AATGAGAGACCAGTGATCTTTGG + Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
969173861 4:5384686-5384708 AGTGAGAGACCATGGAGTGTGGG + Intronic
970301059 4:14681609-14681631 AGTGAGAGTCCTGAGACTGTGGG - Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973255816 4:48112152-48112174 AATGAGAGAACAGTGATTTCAGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976504813 4:85834567-85834589 AGTGAGAAACCAGTGTTCTTTGG + Intronic
976770250 4:88644562-88644584 AGTGAGAGAAAACAGATTGTTGG + Intronic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977153275 4:93541413-93541435 AGTGAGAGTTAAGTGATTCTTGG + Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
980127544 4:128788139-128788161 GCTGAGAGACCAGTGATTCAGGG - Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982126487 4:152188335-152188357 AGCGAGAGTCAAGTGATTGCAGG - Intergenic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982817635 4:159906374-159906396 AGTTAGAGCTCAGTGATGGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
988659538 5:33250344-33250366 AGTGAGAGGCAAGTAATTGCTGG + Intergenic
989162314 5:38403449-38403471 AGTGCAAGAGCAGTGATTCTGGG - Intronic
990717136 5:58649675-58649697 AGGGAGAGACAAGAGCTTGTCGG - Intronic
991085486 5:62644874-62644896 AGTGAGAGTCCAGTGGTGGCTGG - Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994287118 5:97982601-97982623 AGGGAGAGGCCATTGAATGTTGG - Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
1002201357 5:177530504-177530526 AGGGAGAGATGATTGATTGTGGG - Intronic
1003007007 6:2391721-2391743 AGTGAGTGCTCAGTGACTGTGGG + Intergenic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008661931 6:53677677-53677699 AGTGAGAGACCAGGGACAGAAGG + Intergenic
1009321664 6:62298099-62298121 AGAGAGAGAGCAGTGGTGGTGGG + Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010557815 6:77306526-77306548 AGTGAGAGTGCAGGAATTGTGGG - Intergenic
1011359814 6:86511371-86511393 AGGGGGAGAACAGTAATTGTGGG - Intergenic
1012246070 6:96926915-96926937 AGTGAGACATCAGTAATTATGGG - Intronic
1014378651 6:120711156-120711178 ACGGAGAGTCCACTGATTGTGGG + Intergenic
1014865741 6:126527370-126527392 TGTCAGAGACCAGTGATGGAGGG - Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017235206 6:152111499-152111521 ATTGAGAAATCAGTAATTGTGGG + Intronic
1020191529 7:6002667-6002689 AGTGAGAGACCCATGATGTTGGG + Intronic
1020555229 7:9662835-9662857 AGTGAGAGACCAGTGACCCTAGG - Intergenic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023661834 7:42478260-42478282 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1027321545 7:77015619-77015641 AGTGAGAGATCCGTGATGTTGGG - Intergenic
1027325179 7:77043542-77043564 AGTGAGAGATCCGTGATGTTGGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029398902 7:100329050-100329072 AGTGAGAGATCCGTGATGTTGGG + Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1032601381 7:133299894-133299916 AGAGAGATATCAGTGCTTGTTGG - Intronic
1033004923 7:137551292-137551314 AGAGAGAGAGCAGTAAGTGTTGG + Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034585488 7:152088181-152088203 AGTGTGATACAAGTGATTATAGG + Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035528289 8:331900-331922 AGTGGGAGACCAGTGATCCCAGG + Intergenic
1036522561 8:9505496-9505518 AGGGAGAGGCCAGTAATTTTAGG - Intergenic
1039133545 8:34294804-34294826 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1040296303 8:46150850-46150872 AGTGAGACAACAGGGAATGTTGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1041852353 8:62405565-62405587 ACGGAGAGAGCAGTGATTATGGG - Intronic
1043160608 8:76841841-76841863 AGTGAGAGACAAATGATCGCAGG + Intronic
1044124165 8:88437342-88437364 AGGGAGAGCCCAGCGATTCTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045172659 8:99687634-99687656 CGGGAGAGAGTAGTGATTGTGGG - Intronic
1046691889 8:117295106-117295128 AGTGAGGGCTCAGTGAGTGTTGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047940620 8:129824796-129824818 AGTCAGAGACCAGTGATCCCTGG + Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1049415958 8:142495268-142495290 GGTGAGTGACCAGTGATGGCTGG + Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052481339 9:29030911-29030933 AGTGAGGGACCAGCAATTTTAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055705438 9:78995527-78995549 AATTAGATAACAGTGATTGTTGG - Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1057182270 9:93036545-93036567 ATTTAGGGACCAGTGATTGGGGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060234619 9:121853599-121853621 ATTGTGAGACCAGTGACTGCAGG + Intronic
1061517708 9:131099028-131099050 AGTCACAGATCAGTGCTTGTGGG - Intronic
1061664777 9:132154120-132154142 AGTGAGAGACCAGTGGCAGCTGG + Intergenic
1187132591 X:16517163-16517185 AGAGACAGCCCAATGATTGTGGG + Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190418168 X:50201350-50201372 AGTGAGAGACATTTGGTTGTGGG - Intergenic
1191129835 X:56995706-56995728 AGTGAGAGAGAGGTGGTTGTGGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195618738 X:106932835-106932857 AGTAAGAGTTCAGTGAGTGTGGG - Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG + Intergenic
1199274618 X:145926477-145926499 AGTGATAGCCAAGTGATTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199511554 X:148628168-148628190 AGTGAGAGACTGGTGATGGGGGG + Intronic
1199685826 X:150264337-150264359 AGTGAGAACCCAGTGTCTGTGGG - Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic