ID: 1094649934

View in Genome Browser
Species Human (GRCh38)
Location 12:32365755-32365777
Sequence AAGCTGTTGGAGAAGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 325}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094649932_1094649934 -5 Left 1094649932 12:32365737-32365759 CCACTCAGATAGGCAGGAAAGCT 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1094649934 12:32365755-32365777 AAGCTGTTGGAGAAGACAAAAGG 0: 1
1: 0
2: 1
3: 25
4: 325
1094649930_1094649934 4 Left 1094649930 12:32365728-32365750 CCTAAATTACCACTCAGATAGGC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1094649934 12:32365755-32365777 AAGCTGTTGGAGAAGACAAAAGG 0: 1
1: 0
2: 1
3: 25
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094649934 Original CRISPR AAGCTGTTGGAGAAGACAAA AGG Intronic
900034450 1:395381-395403 AAGCTGTTTGAAAAGAGAATTGG + Intergenic
900055283 1:625269-625291 AAGCTGTTTGAAAAGAGAATTGG + Intergenic
900282674 1:1881270-1881292 AAGCTGCTGTAGAAGAGGAAAGG - Intronic
902824826 1:18965742-18965764 AAGCTGGTGGAGAAGACAGGAGG - Intergenic
903310895 1:22454626-22454648 GAGATGTTGGAGAACTCAAAGGG + Intronic
905893933 1:41533311-41533333 AAGCTGTGGGAGAGGACAGTGGG - Intronic
906326440 1:44849084-44849106 AAGGAGCTGGAGAAAACAAAAGG - Intergenic
906901315 1:49839672-49839694 AAGCTGTTGTACAAGTCCAAGGG + Intronic
906973229 1:50541033-50541055 AATCTATTTGAAAAGACAAACGG + Intronic
907096337 1:51784632-51784654 AAGCTGTAGTTCAAGACAAAAGG - Intronic
908353513 1:63309450-63309472 AAGCTACTGGAGATGAGAAAGGG + Intergenic
908646633 1:66285507-66285529 TGGCTGTTGGAGACTACAAAAGG - Intronic
908882876 1:68752529-68752551 ATGCTGAAGGATAAGACAAAGGG + Intergenic
910004448 1:82379255-82379277 AAGCTGGGGAAGAAAACAAAAGG + Intergenic
910712525 1:90196405-90196427 AAGTTGTGGGAGAAGACACATGG - Intergenic
911603762 1:99876809-99876831 ATTCTGTTTGAGAAGATAAAAGG - Intronic
912272623 1:108226570-108226592 CAGCTGTTGGAGAGAACAAATGG + Intronic
912295596 1:108467752-108467774 CAGCTGTTGGAGAGAACAAATGG - Intronic
912842005 1:113047149-113047171 AAGCTATTGGGGGAGGCAAAAGG + Intergenic
913197195 1:116467089-116467111 AAGATGATGGTGAAGAGAAAAGG + Intergenic
915028843 1:152858761-152858783 TAGGTGTTGGAAAAGACAAGGGG + Intergenic
917307420 1:173640773-173640795 AGGCTGTAGGAGCAGACAATTGG - Intronic
919112580 1:193239324-193239346 AATCTGATGGAGAAAACAACTGG - Intronic
919537350 1:198804569-198804591 AAGCTGTTGGCTGACACAAATGG + Intergenic
920078286 1:203353065-203353087 AACCTATTGGAGAAACCAAAAGG - Intergenic
920234410 1:204493470-204493492 AAGCGGGTGGAGAGGAGAAAAGG + Intronic
922130900 1:222776685-222776707 AAGCTTTTATAGAAGACTAAAGG + Intergenic
922256806 1:223899586-223899608 AAGCTGTTTGAAAAGAGAATTGG + Intergenic
922442189 1:225665080-225665102 AAGTTGTTGAAGAAGAGAATGGG - Intergenic
922605145 1:226885518-226885540 ATGCTGAGGGAGAAGGCAAAGGG - Exonic
924037285 1:239950184-239950206 AAGCTGATGGAAAAGATACATGG + Intergenic
924232398 1:241973035-241973057 GAGCTGTAGGAGAAGGGAAAAGG + Intergenic
924338004 1:243002401-243002423 AAGCTGTTTGAAAAGAGAATTGG + Intergenic
1063470479 10:6280625-6280647 AAGCAGATGGAGAAGACAGCAGG - Intergenic
1064853324 10:19735440-19735462 AAGGTGTTGAAGAGGAGAAAAGG + Intronic
1065185570 10:23167523-23167545 TTACTGTTGGAGACGACAAAGGG + Intergenic
1065521657 10:26579627-26579649 AAGCTGCTGGAGAAGAACAGAGG + Intergenic
1066274501 10:33855627-33855649 AAACTGTTATAGAAGCCAAAAGG - Intergenic
1066430874 10:35350036-35350058 AAGCTGGAGGAGGAGACATAGGG - Intronic
1067005815 10:42660899-42660921 AAGATGTTGAAGAAAAAAAAAGG - Intergenic
1067305684 10:45061916-45061938 AAGCTGCTGGAGAAGATGCAGGG - Intergenic
1067914451 10:50381430-50381452 AAGCAGTTGGAGTAAATAAATGG + Intronic
1068674975 10:59761476-59761498 AAGCTGTTTGGAAGGACAAAGGG - Intergenic
1069261210 10:66400792-66400814 AAGCTGTTGGAAGAGAAAATAGG - Intronic
1069626821 10:69873256-69873278 AAGCTGTTGGATTAGTCCAAAGG - Intronic
1070226497 10:74513490-74513512 AAGCTGTAAAAGAAGACAGAGGG - Intronic
1071752575 10:88497151-88497173 AAGTTGTTTTGGAAGACAAACGG + Intronic
1073727740 10:106253833-106253855 GTGCTGTTGGGGAAGATAAAAGG - Intergenic
1074183209 10:111080485-111080507 AAACAGTTTGAAAAGACAAATGG + Exonic
1074688733 10:115983195-115983217 AAGCAGTTTGAGAAAAAAAATGG - Intergenic
1075228879 10:120654629-120654651 AAGCTGGGGGAGAAGAGAAGGGG + Intergenic
1076388114 10:130073992-130074014 AAGCTCTTGGCTAAGACACAGGG - Intergenic
1077347021 11:2065549-2065571 AAGCAGTTGGAGCAGGAAAATGG - Intergenic
1077863223 11:6201033-6201055 ATGATGTTGGCCAAGACAAATGG - Intergenic
1080760791 11:35246927-35246949 AAGCTGTTGGAGAATTCCAGGGG + Intergenic
1082630715 11:55538764-55538786 AAGCTTTTAGAGAAAACATAAGG - Intergenic
1083477451 11:62923379-62923401 AGGCGGTGGGAGAAGAGAAAAGG - Intergenic
1085002774 11:73055851-73055873 GGGCTGTGGGAGGAGACAAAGGG + Intronic
1085389496 11:76175301-76175323 GTGCTGGTGGAGAAGACAGACGG + Intergenic
1086911135 11:92474106-92474128 AAGCTGTTGGAGCAGTGCAAGGG - Intronic
1087582383 11:100074273-100074295 GAGCAGTTAGAGAAAACAAAAGG + Exonic
1088247767 11:107835772-107835794 AAGCTATGGGAGCAGAGAAACGG + Intronic
1089291139 11:117438598-117438620 AATCTGTCGAAGTAGACAAATGG - Intronic
1089472801 11:118734384-118734406 TAGCAGTTGGAGATGACAAGAGG + Intergenic
1090470649 11:126978212-126978234 AAAATGTTGGAGAAGAGGAAGGG - Intronic
1091414759 12:271807-271829 AAGCTCTAGGAGATGACAAGTGG - Intergenic
1093103055 12:15050913-15050935 AAGCTATTGGAGAATAAAACTGG - Intergenic
1094090844 12:26647408-26647430 ATGCTGTTGTAAAAGAAAAAAGG + Intronic
1094226208 12:28048971-28048993 GAGCTGTTGGAAAACAGAAATGG + Intergenic
1094615292 12:32030759-32030781 AATTTGATGGAGGAGACAAATGG - Intergenic
1094649934 12:32365755-32365777 AAGCTGTTGGAGAAGACAAAAGG + Intronic
1095371796 12:41476601-41476623 AAGCTCTTAGAGTAGACCAAAGG - Intronic
1095578145 12:43762989-43763011 AAGCTGTTTGGCAATACAAATGG - Intronic
1097102240 12:56597966-56597988 AAGATTTGGGAGAAGAGAAAAGG + Exonic
1097930744 12:65182531-65182553 AAGCTGTCTGAGCAGATAAAAGG + Intronic
1099606655 12:84810987-84811009 AAGTAGTTAGAGAAGAGAAAGGG + Intergenic
1100286825 12:93174577-93174599 AAGCAGTTGGAGAAGCAAGAAGG + Intergenic
1101755148 12:107615676-107615698 GAGCTGTTTCAGAAGACACATGG - Intronic
1101889824 12:108703216-108703238 AAGCTAATGTAGAAGAAAAAAGG + Intronic
1102079327 12:110085323-110085345 AGACTGGTGGAGAAGACAACAGG - Intergenic
1102592252 12:113965796-113965818 AAACTGTTGGGGAAGACATGGGG - Intronic
1104354327 12:128071830-128071852 ATACATTTGGAGAAGACAAATGG - Intergenic
1104397781 12:128449225-128449247 AAACTCTTGGAGCAGAAAAATGG - Intronic
1105288321 13:19026966-19026988 CAGGTGTTGAAGAAGAGAAAAGG - Intergenic
1105418255 13:20231819-20231841 AACCTGTTGTACAAGTCAAAGGG + Intronic
1106727922 13:32505128-32505150 AAGATGATTGAGAAGGCAAAGGG - Intronic
1107324729 13:39229565-39229587 ACGCTGTTGGACCAGACAACCGG - Intergenic
1108269012 13:48740289-48740311 AAAGTTTTTGAGAAGACAAATGG + Intergenic
1109285022 13:60398435-60398457 GAGCTGCTGGAGATGACACAGGG + Intronic
1110074023 13:71215760-71215782 ATGCTCCTGGAGAAGTCAAAAGG + Intergenic
1111029148 13:82573159-82573181 AAGGTGTTGTAGCAGACAAAGGG - Intergenic
1111815678 13:93149736-93149758 TAACTATTGGAGCAGACAAAAGG + Intergenic
1111980358 13:95008946-95008968 CAACTGTTGGTGAAGACACAAGG + Intergenic
1112243329 13:97703832-97703854 AACCTGATAAAGAAGACAAAGGG - Intergenic
1112382919 13:98910083-98910105 AAGCTGTGGAAGAAAACATAAGG + Intronic
1113172779 13:107524258-107524280 AAGATGTTGGAAAAGTCAAGTGG + Intronic
1113267380 13:108634407-108634429 AAGCTGATGCAGGAGAGAAAGGG - Intronic
1114755170 14:25251623-25251645 AACCTTTTTGAGAAGACAAAAGG + Intergenic
1115720113 14:36151518-36151540 GAACTGTGGGACAAGACAAAAGG - Intergenic
1115914997 14:38302057-38302079 AAGCAGTGGGAGAAGACCATGGG - Intergenic
1117562835 14:56960895-56960917 AAGGTGTTTGAAAATACAAATGG - Intergenic
1118121114 14:62844246-62844268 AAGATATTGGAAAATACAAAAGG + Intronic
1118192625 14:63594396-63594418 AGACTGTTGGAGAAGAGATAGGG + Intergenic
1118690477 14:68334202-68334224 AAAGTTTTGGAGAAGCCAAAAGG - Intronic
1118922807 14:70165572-70165594 AGAAGGTTGGAGAAGACAAACGG - Intronic
1118965624 14:70581464-70581486 AAGCTGTGTGAAGAGACAAAGGG - Intronic
1119179168 14:72593105-72593127 AAGCTGCAGGAGAGGACAGAAGG + Intergenic
1119626655 14:76182882-76182904 AAGCTGTCATAGAAGACAACAGG + Intronic
1119908682 14:78329528-78329550 AAGCTGTTAATGAAGCCAAAAGG - Intronic
1120210999 14:81633748-81633770 AGGCTGGAGGAGTAGACAAATGG + Intergenic
1121891386 14:97594569-97594591 GATCTGTTGGGGAAGAGAAAGGG - Intergenic
1122277581 14:100603135-100603157 AAGATGTGGGAAAAGACAGACGG + Intergenic
1124261176 15:28192929-28192951 AATCTGTTGGAAAAAAAAAAAGG - Intronic
1124828518 15:33124573-33124595 ATGCTGATGGTGAAGACCAAGGG - Intronic
1124871565 15:33548490-33548512 AACCTGTTTAAGAAAACAAATGG - Intronic
1126424917 15:48516844-48516866 AGGCTGTTGCAGAAGACCAAGGG + Intronic
1126490692 15:49232457-49232479 ATGCTGATGGCCAAGACAAAGGG - Intronic
1126818722 15:52479910-52479932 AAACTGGTGGAGAAGAGCAAAGG - Intronic
1127429053 15:58884192-58884214 AAGATGTCTGAGAAGATAAAAGG + Intronic
1129130741 15:73491924-73491946 AAGCTGGTGGAAAAGCAAAATGG - Intronic
1134369627 16:13611033-13611055 AGGCTGGTGTAGAAGAGAAAAGG - Intergenic
1135258179 16:20958450-20958472 AAGTTGTTGGAGAAGGTAATAGG - Intronic
1135675571 16:24412186-24412208 AAGCTGCTGAAAAAGTCAAAAGG - Intergenic
1137893675 16:52188011-52188033 AAGCTCCTGGAGATGTCAAAGGG - Intergenic
1138828928 16:60355438-60355460 AAGCTGATGGACAAAACAAGTGG - Intergenic
1138901182 16:61273163-61273185 AAGCTGTTGGGAAATACATAAGG - Intergenic
1139283328 16:65788402-65788424 AAGCTGTTAGATAAAATAAAGGG - Intergenic
1140350449 16:74257440-74257462 AAGCTGTGAGAGAACAGAAAAGG + Intergenic
1140701919 16:77588885-77588907 AAGCTGTCTGGGAAGACAGATGG + Intergenic
1140726367 16:77816617-77816639 AGGCTCTGAGAGAAGACAAAGGG + Intronic
1142107167 16:88310309-88310331 GAGCTGTTGGCTAAGACACAAGG + Intergenic
1146318135 17:31825207-31825229 AACATTTTGGAGAAGAGAAAAGG - Intergenic
1146799956 17:35810208-35810230 AAACTGGTGGGGAAGACGAATGG - Intronic
1147009994 17:37437879-37437901 AAGCTGTTGTTGAAGAGTAAAGG + Intronic
1147125418 17:38364684-38364706 AAGCTGATGCAGAAAGCAAAGGG - Intronic
1148874090 17:50676258-50676280 ACCCTGTTGGAGAAGGCAGAGGG - Exonic
1149329378 17:55565744-55565766 AAGCTGGTGAAGAAGAGAGATGG + Intergenic
1151210538 17:72540761-72540783 AAGTTGCTGGAGAAGAGAATGGG - Intergenic
1151407661 17:73899907-73899929 AAGCCCTTGGAGAAGGGAAATGG - Intergenic
1154331074 18:13429342-13429364 AAACTGTGGGAGCAGAGAAATGG + Intronic
1155129556 18:22918604-22918626 AAGCTGTTGGAAAACTCAGAAGG - Intronic
1155249527 18:23941300-23941322 AAGCTGATGGAGAGGCCACAAGG - Intronic
1155391397 18:25340989-25341011 ATGATGTTGGAGGAGGCAAAAGG + Intronic
1156023359 18:32624369-32624391 GAGCTGTTGGAGCACTCAAAGGG - Intergenic
1157419148 18:47531006-47531028 AAGCTGGTGCAGAAGAGAAGAGG - Intergenic
1157706762 18:49813853-49813875 AGGGTGTTGGCGGAGACAAAGGG - Exonic
1159100390 18:63951454-63951476 AAACTGTGGGAGATGAGAAATGG + Intronic
1159702166 18:71641941-71641963 AAGCTGTTGTAGAATCCCAAAGG - Intergenic
1159855100 18:73577407-73577429 AAGCTGATAGAGAAAACAAAAGG - Intergenic
1163389402 19:17021259-17021281 AAACTGTTGCAGAAGCCAACTGG + Intronic
1164228710 19:23269075-23269097 ATGCTGTCAGAGAAGAGAAATGG - Intergenic
1164230844 19:23286747-23286769 AAGCTGGTGGCTAAGACCAAGGG + Intergenic
1164708290 19:30336397-30336419 ATGCTGTTGGACAGGACAAGGGG + Intronic
1164879140 19:31715919-31715941 AAGCAGTAGGAGAAAGCAAAAGG - Intergenic
1166021476 19:40034639-40034661 AAGCTGTGTCAGAAGACCAAAGG + Exonic
1166021546 19:40035395-40035417 AAGCTGTGTCAGAAGACTAAAGG + Exonic
1166021578 19:40035731-40035753 AAGCTGATTGAGGAGACTAAAGG + Exonic
1166025048 19:40075314-40075336 AAGCTGGTTGAGAAGACTAAAGG + Exonic
1167638201 19:50667230-50667252 AAGCTGTTGGAGAATTCCAGAGG + Exonic
1168275052 19:55273353-55273375 AAGCTGTTAGAGAAAATAAAAGG + Intronic
1168283756 19:55320453-55320475 CAGATGCTGGGGAAGACAAAGGG + Exonic
1168375216 19:55871426-55871448 ATGCTTTAGAAGAAGACAAAGGG + Intronic
925267571 2:2577117-2577139 TAGCTGATGGAAAAGGCAAATGG - Intergenic
925979709 2:9166897-9166919 AAGCTCTGGGAGGAGACAGAAGG - Intergenic
926389230 2:12370499-12370521 AAGCTGTGGGAGGAGAGAAGAGG - Intergenic
926529339 2:14023112-14023134 AAGATCTTGGAGAACAAAAATGG + Intergenic
926744858 2:16142839-16142861 AAGATGGTGGAGAAGAAAAATGG + Intergenic
929409021 2:41676158-41676180 AAGCTGTTTGAAAAAATAAAGGG + Intergenic
930258387 2:49117608-49117630 AAGCTGAAGGAGAATAAAAAAGG + Intronic
930688673 2:54336267-54336289 TAGCTGTTGGAGTAGAGGAAGGG - Intronic
930943981 2:57049163-57049185 AAGCTGATGAAGAGGACAATAGG - Intergenic
931143356 2:59488216-59488238 CAGCTGTTTTAGAAGAGAAATGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
933027383 2:77277521-77277543 AAGCTGGTAGAGAAAAGAAATGG - Intronic
934160632 2:89245821-89245843 AATCTGTTAGGGAAGACAGAAGG - Intergenic
934206644 2:89936617-89936639 AATCTGTTAGGGAAGACAGAAGG + Intergenic
934230882 2:90180769-90180791 AAGATGTTGGAGAACTCAGAGGG + Intergenic
934516599 2:94991969-94991991 AAGCTGAGGGAGATGAGAAATGG - Intergenic
935718294 2:105958022-105958044 AAGCTGGTGGACCAGACACACGG - Intergenic
936523010 2:113223771-113223793 AACCTAATGGTGAAGACAAATGG - Intronic
937120305 2:119436230-119436252 AAGCTGCAGGAGCAGACAATGGG + Intronic
937390391 2:121480868-121480890 GAGCTGTTGGAGCCAACAAATGG + Intronic
937619833 2:123972722-123972744 AGGCGGTTGGATAAGACAATTGG + Intergenic
938810749 2:134850616-134850638 AAGGTATTGGACAAGATAAATGG - Intronic
939625442 2:144471574-144471596 AAGCTGTTAGAGAAAAGTAATGG + Intronic
939936445 2:148299052-148299074 AAACTGCTAGAGAAGAAAAAGGG - Intronic
940461632 2:153970902-153970924 AAGATGTTGGAGCAGAGGAATGG - Intronic
940761039 2:157739608-157739630 AAGTTGTTGGAGGCGACAGAAGG + Intronic
940790696 2:158027328-158027350 AAGCAATTGGACAAAACAAAGGG + Intronic
940985897 2:160052043-160052065 AAGCTGTAGGAGAATAAAGAAGG - Intronic
941981015 2:171456870-171456892 AAGCTTTTGGATTAGACAATGGG + Intronic
943676701 2:190722591-190722613 TTGCTGGGGGAGAAGACAAAAGG - Intergenic
946627518 2:221629643-221629665 ATGCTGGTGGAGATGACACACGG + Intergenic
947395055 2:229678238-229678260 AAGCTGTTGGGAAATACGAAGGG - Intronic
948261164 2:236605461-236605483 AAGTTGTGGGCGAGGACAAAAGG - Intergenic
1168944895 20:1745080-1745102 AAGATGTTAGAGAAGGAAAATGG + Intergenic
1169378125 20:5083564-5083586 AAGCTGTGGGTTAAAACAAATGG - Intronic
1169563909 20:6831937-6831959 AAGCTGTGGTAGAAGACATGGGG - Intergenic
1176980005 21:15370858-15370880 TATCTGTTGGAGATGACAGACGG + Intergenic
1177462199 21:21427323-21427345 AAAATTTTGGAGAAGACAAAAGG + Intronic
1178956458 21:37026710-37026732 AAGCTGTTGCAGGAAAGAAATGG - Intergenic
1182088666 22:27579268-27579290 AAGCTCTAGGACAAGGCAAAGGG + Intergenic
1182598972 22:31444852-31444874 AAGCTCTGAGGGAAGACAAAAGG + Intronic
1183836586 22:40459160-40459182 AGGATGTTGGAGATTACAAAAGG + Intronic
949462004 3:4303621-4303643 GCGCTGTAAGAGAAGACAAAAGG - Intronic
951537847 3:23755857-23755879 AAGCCTTTGGAGAAGGCTAAGGG - Intergenic
951601629 3:24382824-24382846 AGGCTGTTGCAGAAGTGAAAGGG - Intronic
952901273 3:38113242-38113264 AAGTTGTTGGTGAAGATACAGGG + Intronic
953462946 3:43096033-43096055 AAACTCTTGAAGGAGACAAAAGG + Intronic
955960837 3:64339962-64339984 AAGCTGTTGGATAAAAATAAGGG + Intronic
957334819 3:78814120-78814142 AAGCTGTTGAAGAGTAAAAAAGG - Intronic
958763581 3:98338509-98338531 AAGATGTAGGAGAAACCAAAAGG + Intergenic
959948234 3:112149736-112149758 AAGCTGCTGAACAAGGCAAATGG + Intronic
960001831 3:112740403-112740425 AATCTATGGGTGAAGACAAATGG - Intergenic
960217282 3:115057105-115057127 GAGGTGTTAGAGAAGACAGAAGG - Intronic
960259416 3:115548644-115548666 CAGCTGTTGGGGAAGACTTAAGG - Intergenic
960385895 3:117021220-117021242 TATCTCTGGGAGAAGACAAAGGG - Intronic
960387260 3:117035392-117035414 CAGCTTTTGGAGACCACAAAAGG + Intronic
960664866 3:120098940-120098962 AAGCTGATAGAGAAGACTAATGG + Intergenic
961095296 3:124149790-124149812 AAGCTTTTGCAGAGGACAGATGG - Intronic
961693239 3:128685685-128685707 AAGCTGGAAGAGAAGAAAAAAGG + Intergenic
963541345 3:146593576-146593598 CTCCAGTTGGAGAAGACAAAGGG + Intronic
964123613 3:153212323-153212345 TGGCTGATAGAGAAGACAAATGG + Intergenic
964137003 3:153355276-153355298 CAGCTTGTGGAGAAGAAAAAAGG + Intergenic
964140198 3:153389494-153389516 AGGCTCTAGGAGAAGAAAAAAGG - Intergenic
964478895 3:157122614-157122636 AAGCTGATGGAAAAGAGGAAGGG + Intergenic
965364530 3:167782595-167782617 AAGCTTTTTGAGGACACAAATGG - Intronic
965410610 3:168326103-168326125 AAACTGTATGAGAACACAAATGG - Intergenic
965677456 3:171212873-171212895 AAGCTTTAGGAAAAAACAAAGGG + Intronic
966736857 3:183193669-183193691 AACATTTTTGAGAAGACAAAGGG - Intronic
967920824 3:194613009-194613031 AAACTTTTGATGAAGACAAATGG + Intronic
969172936 4:5378571-5378593 AAACCAGTGGAGAAGACAAAGGG - Intronic
969428699 4:7140608-7140630 AAGCTAATGGGGAAGACAAGAGG + Intergenic
969662281 4:8537285-8537307 AATCGGTTGCAGAGGACAAAGGG + Intergenic
970276364 4:14405317-14405339 ATGCTGTGGGAACAGACAAAAGG + Intergenic
970458224 4:16246649-16246671 AAGCTGTTGGAAGAGACACATGG - Intergenic
970699172 4:18714282-18714304 AATCTGAAGGAGAAGACACAGGG + Intergenic
973319411 4:48794839-48794861 GAGCTTTGGGAGAAGACACAGGG + Intergenic
973841900 4:54870894-54870916 ATGCTTATGGAGAACACAAAGGG - Intergenic
974079924 4:57201427-57201449 AAGCAGTGAGAGAAGACAGATGG + Intergenic
974473170 4:62345235-62345257 AACTATTTGGAGAAGACAAAAGG + Intergenic
977125083 4:93155340-93155362 AAGATGTTGGGGAGGAGAAAAGG - Intronic
979239121 4:118432889-118432911 AAGCTGTTTGAAAAGAGAATTGG - Intergenic
979424533 4:120549293-120549315 AATCTGTTGCAGAAAACAGAGGG + Intergenic
982592648 4:157334695-157334717 AAGCTGTTGGTGAAATGAAATGG + Intronic
983224456 4:165072963-165072985 ACGCTGATGGAGAAGCCAAGAGG + Intergenic
983754850 4:171322154-171322176 CAGCAGTTAGAAAAGACAAAGGG + Intergenic
984174173 4:176395944-176395966 AAGTTGGTGGGGAAAACAAAAGG - Intergenic
984202497 4:176742892-176742914 CAGGTGCTGGAGAAGACAAGTGG + Intronic
984459356 4:180013497-180013519 AAGCTGTAGAAGAAAACACAAGG + Intergenic
984667080 4:182440479-182440501 AAGCTCTATGATAAGACAAATGG - Intronic
986501323 5:8402834-8402856 AAACTCTGGGAGAAGCCAAATGG + Intergenic
986679736 5:10221987-10222009 AGGCTGGTGGAGCAGACAGACGG - Intergenic
986988746 5:13527460-13527482 ATGCTATTGGAGAAGAGAAATGG + Intergenic
987041301 5:14065448-14065470 GAGCTGTTTGAGTAGACAGACGG - Intergenic
987165542 5:15194318-15194340 AAGCTGATAGAGAAGAGATATGG + Intergenic
988739709 5:34058357-34058379 AAGGTGTGGGAGAAGAGAAAGGG + Intronic
990260647 5:54018265-54018287 ATACTGTTGAAAAAGACAAAAGG - Intronic
990785080 5:59409620-59409642 TAGTTGTTTCAGAAGACAAAAGG - Intronic
992343379 5:75849469-75849491 ACACTGTTGGAAAACACAAATGG - Intergenic
992402593 5:76425312-76425334 AAGAGGATGGAGAAGAAAAAAGG - Intronic
993307928 5:86293418-86293440 CAGCTGTTGGAGAGAACAAATGG - Intergenic
993569797 5:89523098-89523120 AAGCCGTTTGGGAAGCCAAATGG + Intergenic
996176603 5:120367676-120367698 AAGCTGTTAGGGAAGAAAAATGG - Intergenic
996494184 5:124134227-124134249 AAGGTGTTATGGAAGACAAAAGG + Intergenic
996829609 5:127726376-127726398 AAGCTTATGGAGAAGAAAAGGGG - Intergenic
998062856 5:139132804-139132826 AAGCTGAGGGAGAAGGGAAAGGG + Intronic
998369669 5:141652787-141652809 AAGCTGTTGGAGGCGACAGATGG - Intergenic
998396651 5:141822978-141823000 ATGGTGATGGAGAAGATAAAAGG + Intergenic
998961452 5:147491295-147491317 AAGGTGTAGGGGAAGAGAAAGGG - Intronic
999218765 5:149958037-149958059 AAGCTGTTTGGGAAGAGTAATGG + Intergenic
999310261 5:150547279-150547301 AAGATGTTGGAGGAGAGGAAGGG + Intronic
999320788 5:150613889-150613911 AAGCTGTAGAAGAAGGGAAAGGG - Intronic
999800050 5:155025190-155025212 ACTCTATAGGAGAAGACAAAGGG - Intergenic
999961506 5:156760906-156760928 AAGCTGATAGACAAGCCAAATGG + Intronic
1000496266 5:161989224-161989246 GAGCTATTGGACAAAACAAAGGG + Intergenic
1001695109 5:173664175-173664197 AGGCTGCTGCAGAAGAGAAATGG - Intergenic
1002371040 5:178754878-178754900 AGGCTGTGGGTGAAGAGAAAAGG + Intergenic
1002739369 5:181423487-181423509 AAGCTGTTTGAAAAGAGAATTGG - Intergenic
1005109457 6:22264104-22264126 AAACTGGTAGAGAAGAGAAAGGG - Intergenic
1005112754 6:22301966-22301988 AAGCTGTTGAAGAAGCCTTATGG + Intergenic
1005181277 6:23109649-23109671 ATCCTGTTGCAAAAGACAAATGG + Intergenic
1006912115 6:37570224-37570246 AAGGAGGTGGAGATGACAAATGG + Intergenic
1007506215 6:42337285-42337307 CAGCTGTTGAAGAAGATGAAGGG - Intronic
1008050065 6:46891896-46891918 AAGCTGTTGGAGAACATAAAAGG - Intronic
1008127434 6:47684700-47684722 AGGCTGATGGAGCAGACAGAGGG + Intronic
1010264099 6:73848564-73848586 AAGCTGTACTAGAAAACAAATGG - Intergenic
1011665965 6:89634230-89634252 AAGGTATTGTAGAATACAAAAGG - Exonic
1011971037 6:93223185-93223207 AAGGTGTTGGAAAAGACTGAAGG + Intergenic
1012666741 6:101980295-101980317 AAGCAGTTGGATAAGTAAAATGG - Intronic
1013274186 6:108568401-108568423 GTGCTGATGGAGAACACAAAAGG - Intronic
1014960961 6:127684066-127684088 AAACTGTAAGAGAAGAAAAAAGG + Intergenic
1015355163 6:132269416-132269438 AAGCTGTTGGAGAAAAGGAAAGG + Intergenic
1015747010 6:136520888-136520910 AAGAGGATGGAGAAGGCAAAAGG + Intronic
1015798889 6:137041206-137041228 CACCAGTTGGAGAAGACTAAGGG + Intronic
1016795237 6:148110491-148110513 AAGGAGTAGGAGAAGAGAAATGG - Intergenic
1017158896 6:151347177-151347199 AAGCTGATGGAGGTGTCAAAAGG - Intronic
1017917485 6:158842986-158843008 AAGATGTTGGAGCAGAAGAAAGG - Intergenic
1020250675 7:6465878-6465900 AAGCTATTGCAAAAGAAAAAGGG + Intronic
1021012830 7:15492880-15492902 AAGATGTAGGAGAAGACAGAGGG - Intronic
1021632654 7:22662103-22662125 AAGTTGTTGTGAAAGACAAAGGG - Intergenic
1022144231 7:27521437-27521459 AAGCTGTTAGGGAAAATAAAAGG + Intergenic
1022480231 7:30738785-30738807 AAGCTGGTGGTGCAGACCAACGG + Intronic
1022854241 7:34300014-34300036 TAGGTGTGGGAGAAGACACATGG - Intergenic
1023254731 7:38301810-38301832 AAGCTGTTGGGGAAATTAAATGG - Intergenic
1023756775 7:43425932-43425954 AAGGTGCTGGAGTAGAAAAAAGG - Intronic
1026395987 7:69954892-69954914 TAGCCTTTGGAGAAGCCAAATGG + Intronic
1027575461 7:79924931-79924953 AAACTCTTTAAGAAGACAAATGG + Intergenic
1032448294 7:132003532-132003554 GAGCTTTGGGAGAAGACAAAAGG - Intergenic
1034186121 7:149178712-149178734 CTGCTGGTGGAGAAGAGAAAGGG - Exonic
1034212680 7:149378058-149378080 AAGCTCATGGTGGAGACAAAAGG - Intergenic
1035503645 8:109126-109148 AAGCTGTTTGAAAAGAGAATTGG + Intergenic
1037196641 8:16198825-16198847 ATCCTTTTGGAGAAAACAAAAGG - Intronic
1039729357 8:40257489-40257511 AAGCTGAAGGAAAAGACATATGG + Intergenic
1042060051 8:64806724-64806746 AAGCTGCAGGAGAAAATAAAAGG - Intergenic
1043485140 8:80691780-80691802 AAGTTGCTGAAGAAGACAATAGG - Intronic
1043629105 8:82305958-82305980 CAGCAGTTGATGAAGACAAATGG + Intergenic
1048972576 8:139653526-139653548 GAGCTGTTGGAGAGAACAAGAGG - Intronic
1049990735 9:989311-989333 AAGTTGCTGGAGAGGAAAAAAGG - Intronic
1050306615 9:4311625-4311647 TTGCTGTTGGGGAAGACAGATGG - Intronic
1052273897 9:26656736-26656758 CAGCTGGTGGAGGGGACAAAAGG - Intergenic
1052298807 9:26930428-26930450 TAGTTGTTGGAGCAGTCAAAGGG - Intronic
1052636059 9:31105900-31105922 TAGGTGTTGGAGTAGACATATGG - Intergenic
1053251697 9:36579500-36579522 ATTCTAGTGGAGAAGACAAAAGG - Intronic
1055127108 9:72731451-72731473 TAGGTGTAGGAGAAGAGAAAGGG + Intronic
1055869526 9:80857511-80857533 ATGTTGCTGGAGAAGACAAAAGG + Intergenic
1056251323 9:84751263-84751285 AAGCTGGTGAAGAATACAATGGG - Intronic
1056646907 9:88420733-88420755 AAAATGTTGGAAAAGACTAAAGG - Intronic
1058865229 9:109155961-109155983 AAACTGTTGCAGAAAAAAAATGG + Intronic
1058983854 9:110194320-110194342 AAGCTGCTGGAGGGGAAAAAGGG + Intronic
1059219452 9:112599684-112599706 AGGCAGTTGTAGAAGACACATGG - Intronic
1059230812 9:112719823-112719845 AAACTCTAGGAGAAGACAGAAGG - Intergenic
1060574056 9:124672721-124672743 AAATTGTTGGTGAAAACAAATGG - Intronic
1060610973 9:124964183-124964205 AAGCAGTGGCAGAAAACAAATGG - Intronic
1060709675 9:125846628-125846650 AAGCTGATGGAGGTGACAATGGG - Intronic
1060911454 9:127354389-127354411 AACAAGTTGGAGAAAACAAAAGG + Exonic
1061679078 9:132233881-132233903 AAGCTGTTTCAGAAGAAAAAAGG + Intronic
1203604668 Un_KI270748v1:48272-48294 AAGCTGTTTGAAAAGAGAATTGG - Intergenic
1186066884 X:5776086-5776108 AAGTAGGTGGAGAAGATAAAAGG + Intergenic
1188181309 X:27059345-27059367 AAGCTGCCAGAGAATACAAAAGG - Intergenic
1188679662 X:32986870-32986892 GAACTGTTTGAGAAGACATAGGG + Intronic
1190519072 X:51258513-51258535 AATCTGTTGGAAAATCCAAATGG + Intergenic
1192882113 X:75296728-75296750 AAGCTGCTGGTGAGCACAAATGG + Intronic
1193680955 X:84518547-84518569 AAGCTGGTAGTGAAGACAAAGGG - Intergenic
1194597909 X:95881851-95881873 CAGCACTTGGAGAAGCCAAAGGG - Intergenic
1195338630 X:103882003-103882025 GAGAAGATGGAGAAGACAAAAGG - Intergenic
1196425419 X:115563658-115563680 AGGCTGCTGCAGGAGACAAAGGG - Intronic
1198629749 X:138622928-138622950 AAGTAATTGAAGAAGACAAATGG - Intergenic
1199581132 X:149361452-149361474 AGGTTGTTGCTGAAGACAAAAGG + Intergenic
1202025492 Y:20518435-20518457 AAGCAGTTGGACAAGGCAGAAGG + Intergenic
1202386870 Y:24334683-24334705 AAGCTGTTTGAAAAGAGAATTGG - Intergenic
1202483916 Y:25335445-25335467 AAGCTGTTTGAAAAGAGAATTGG + Intergenic