ID: 1094654788

View in Genome Browser
Species Human (GRCh38)
Location 12:32409727-32409749
Sequence TAAACCTTACCAGTAACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094654787_1094654788 -2 Left 1094654787 12:32409706-32409728 CCTTAGTGATTGATTGTTGGTTA 0: 1
1: 0
2: 1
3: 13
4: 111
Right 1094654788 12:32409727-32409749 TAAACCTTACCAGTAACCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 95
1094654785_1094654788 11 Left 1094654785 12:32409693-32409715 CCAGAAATAATTGCCTTAGTGAT 0: 1
1: 0
2: 0
3: 9
4: 183
Right 1094654788 12:32409727-32409749 TAAACCTTACCAGTAACCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094654788 Original CRISPR TAAACCTTACCAGTAACCCC TGG Intronic
905021677 1:34819625-34819647 TATACCTTCTCCGTAACCCCTGG - Intronic
909712250 1:78665416-78665438 GAAACCTTACTAGTAGCCCCAGG + Intergenic
912548201 1:110466180-110466202 TAAACAGGAACAGTAACCCCTGG + Intergenic
919234664 1:194825115-194825137 TAAAGCTTACGAGTGACCCTTGG + Intergenic
919258289 1:195155257-195155279 AAAGCCTTAGGAGTAACCCCAGG + Intergenic
920816611 1:209340414-209340436 TTAATCTTTCCAGTAACCTCAGG + Intergenic
924244219 1:242066060-242066082 TACACATGACCAGTAAGCCCAGG - Intergenic
924251637 1:242139140-242139162 CAAAACTTGTCAGTAACCCCAGG + Intronic
1063083300 10:2789428-2789450 TACATCTTACCTGTTACCCCGGG - Intergenic
1066761396 10:38756935-38756957 TCAACCTCACCACTAACCCTTGG - Intergenic
1066960186 10:42215489-42215511 TCAACCTCACCACTAACCCTTGG + Intergenic
1067432371 10:46252776-46252798 TAAACCTCACAAGTGCCCCCAGG - Intergenic
1067440863 10:46308618-46308640 TAAACCTCACAAGTGCCCCCAGG + Intronic
1067469659 10:46527383-46527405 TAGACCTGCCCAGTGACCCCAGG - Intergenic
1067576999 10:47415308-47415330 TAAACCTCACAAGTGCCCCCAGG + Intergenic
1075761956 10:124863916-124863938 TGAACCCTACCAGTGGCCCCAGG - Intergenic
1077933077 11:6753797-6753819 TAAACCTAACCAGTACCACCAGG - Intergenic
1089666094 11:120020666-120020688 TAAACATTTCCATTACCCCCTGG - Intergenic
1094149233 12:27264009-27264031 TCAACCTCACCACTAACCCTTGG - Intronic
1094654788 12:32409727-32409749 TAAACCTTACCAGTAACCCCTGG + Intronic
1097820852 12:64127980-64128002 CAAGCCTTGCCAGTCACCCCCGG + Exonic
1100626178 12:96334930-96334952 TAAAGATTTCCAGTAAACCCAGG - Intronic
1102870630 12:116411231-116411253 AAAACAATACCAGTAAGCCCCGG - Intergenic
1106677908 13:31981083-31981105 TAACCATTACCAGTTTCCCCAGG - Intergenic
1107129397 13:36879290-36879312 TAACCCTTACCACTACCGCCGGG - Exonic
1112040492 13:95542297-95542319 CAAACCTTATCAGCAACCACAGG + Intronic
1113325293 13:109275691-109275713 TCAATCTTTCCATTAACCCCTGG - Intergenic
1114082434 14:19212931-19212953 TAAAACTGACCAGTAATCCCAGG + Intergenic
1114458833 14:22874139-22874161 TAAACATTCCAAGTCACCCCAGG + Intronic
1117691279 14:58309560-58309582 TAAATGTTACCACTAACTCCTGG + Intronic
1124533857 15:30527302-30527324 TATACCTTCCCAGTATCCCCAGG + Intergenic
1124764791 15:32480307-32480329 TATACCTTCCCAGTATCCCCAGG - Intergenic
1127840122 15:62824048-62824070 TAAACTTTATTAGGAACCCCCGG - Intronic
1128723603 15:69971506-69971528 TTAATCTTCACAGTAACCCCAGG + Intergenic
1129880274 15:79002019-79002041 CAAACCTTACCAGACACACCTGG + Intronic
1130151395 15:81314492-81314514 TCAGCCTCACCAGGAACCCCAGG + Intronic
1135901964 16:26468578-26468600 TAAACCATCCCTGTAATCCCTGG - Intergenic
1137575272 16:49595338-49595360 CAAATCTTTCCAGAAACCCCAGG + Intronic
1141764677 16:86050685-86050707 TGATGCTTACCAGTACCCCCTGG - Intergenic
1146783174 17:35694573-35694595 TAAAGTTTAACAGTAAACCCAGG + Intronic
1146830389 17:36064131-36064153 TAAACCTTTCAAGTAACCATAGG + Intergenic
1147924067 17:43935932-43935954 CAAACCCTGACAGTAACCCCTGG + Intergenic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1149049836 17:52291331-52291353 AAAACCTTACCTGTAATCCTTGG - Intergenic
1153532697 18:6065169-6065191 TAAACCATACCTGCAACCCTGGG + Intronic
1155850444 18:30768010-30768032 TTAACCTTCACAGTAACCCATGG + Intergenic
1160403178 18:78626007-78626029 TAAACCACACCAGTAATCTCAGG - Intergenic
1160851095 19:1193088-1193110 TAGAACTTACCTGTAAGCCCAGG + Intronic
1161998430 19:7728886-7728908 TAATCCGTACGAGTGACCCCTGG - Intergenic
1164749203 19:30639125-30639147 TAAAAATTACCAGGAACACCAGG - Intronic
1167006727 19:46781087-46781109 TGAATCTTCCCAGCAACCCCCGG + Intronic
926539194 2:14153738-14153760 CAAACTTTACCAATAATCCCAGG + Intergenic
930649355 2:53949108-53949130 CAAACCTTAACAGAAACCTCTGG + Intronic
934324709 2:92001609-92001631 TCAACCTCACCACTAACCCTTGG - Intergenic
936069388 2:109355337-109355359 TAAACCAAACCAGAAACCACAGG - Intronic
938494150 2:131783673-131783695 TAAAACTGACCAGTAATCCCAGG - Intergenic
939000665 2:136730214-136730236 TAGTCCTTAATAGTAACCCCTGG - Intergenic
942133545 2:172903717-172903739 TGATCCTACCCAGTAACCCCCGG - Intronic
942295308 2:174511101-174511123 TAAGCCTCACCTGTAAGCCCAGG - Intergenic
942882387 2:180876789-180876811 TAAACCATCCCAGCAACCCTGGG - Intergenic
943476399 2:188362622-188362644 TTAAATTTACAAGTAACCCCAGG + Intronic
943678144 2:190737465-190737487 TAAAGCTTACCAGTAAAATCTGG - Intergenic
946038647 2:216765224-216765246 TAACCCCTACCCTTAACCCCCGG - Intergenic
946234320 2:218313607-218313629 TCATCATTACCAGTAACCCTGGG + Intronic
946416183 2:219540936-219540958 TAGACCATACCTGTAACTCCTGG + Exonic
948256416 2:236571783-236571805 TAAACCTTAAGAGTAACCGAGGG + Intronic
1172054290 20:32143320-32143342 TACCCCTTCCCAGCAACCCCAGG + Intronic
1174537745 20:51265635-51265657 TGAACCTTGCCAGCAACCCCAGG + Intergenic
1176613765 21:9010706-9010728 TAAAACTGACCAGTAATCCCAGG + Intergenic
1176711425 21:10153183-10153205 TAAAACTGACCAGTAATCCCAGG - Intergenic
1180498343 22:15909739-15909761 TAAAACTGACCAGTAATCCCAGG - Intergenic
1180584212 22:16871394-16871416 TCAACCTCACCACTAACCCTTGG - Intergenic
1182358347 22:29732875-29732897 TACACCTTACCCCTATCCCCTGG - Intronic
949571175 3:5294606-5294628 GAAACCTTCCCAGGAACTCCGGG + Intergenic
952447268 3:33393685-33393707 TAAACATTAACAGAAATCCCTGG + Intronic
952825964 3:37525215-37525237 TAAACATTACCAGTTAAACCAGG + Intronic
954109173 3:48424669-48424691 TATCCCTTACCAGTGGCCCCAGG - Intronic
954600861 3:51867475-51867497 TAAAACTGACCAGTAAATCCAGG - Intergenic
959516054 3:107268447-107268469 TGTAGCTTACCAGTATCCCCAGG - Intergenic
961622801 3:128238112-128238134 TAATCCTCACCACTATCCCCTGG - Intronic
970715545 4:18917977-18917999 CAAACCTAACCTCTAACCCCTGG - Intergenic
975031127 4:69618323-69618345 TAAGTCCAACCAGTAACCCCAGG + Intronic
988510849 5:31863347-31863369 TAATGCTTAACAGGAACCCCTGG - Intronic
991978925 5:72211539-72211561 AAAACATTGCCAGTAACCCCTGG - Intergenic
993304358 5:86256489-86256511 TAAACCTTACCAGTGAACCTAGG - Intergenic
993925910 5:93865956-93865978 TAATTCTTACTAGCAACCCCTGG - Intronic
993998071 5:94746050-94746072 AAAACTTTCCCAGAAACCCCCGG + Intronic
998522180 5:142811147-142811169 TGAAACTTAACAATAACCCCAGG - Intronic
998522238 5:142811675-142811697 TTAAACTTAACAATAACCCCAGG - Intronic
998830106 5:146148468-146148490 TAAACCTAACTATTAATCCCAGG + Intronic
1007389834 6:41544766-41544788 TTAATCTTCACAGTAACCCCAGG - Intergenic
1008506022 6:52230699-52230721 TAAAGCTTCCCAGAAAACCCTGG + Intergenic
1008690629 6:53974787-53974809 TTAACCTGTCCAGGAACCCCTGG + Intronic
1017456752 6:154607513-154607535 TAAATCTTCCCAGAAACCACTGG + Intergenic
1020714418 7:11652168-11652190 TAAACCACACCAGTAAACCAGGG + Intronic
1023157502 7:37265734-37265756 TAAACCTTAAGAGTGTCCCCAGG + Intronic
1027172860 7:75885185-75885207 TAAACCTCACCAGAAAACCTGGG - Intronic
1030666437 7:112283612-112283634 TAGACCTTTGCAGTAACCACAGG + Intronic
1032988142 7:137361684-137361706 TAAGCCCTACCAGTACCACCAGG - Intergenic
1037658126 8:20904738-20904760 GAAACCTCACAAGTAACCACTGG - Intergenic
1039742378 8:40394451-40394473 TAAACCTTTCAAGTATGCCCAGG + Intergenic
1046947044 8:119984042-119984064 AAATCCTTCCCAGGAACCCCAGG - Intronic
1048620305 8:136125384-136125406 TGAACCTGAGCAATAACCCCTGG - Intergenic
1049547590 8:143240776-143240798 AGAACCTTAGCAGTGACCCCAGG - Intergenic
1053648412 9:40138874-40138896 TAAAACTGACCAGTAATCCCAGG - Intergenic
1053757327 9:41324968-41324990 TAAAACTGACCAGTAATCCCAGG + Intergenic
1054329391 9:63736817-63736839 TAAAACTGACCAGTAATCCCAGG - Intergenic
1054536169 9:66237296-66237318 TAAAACTGACCAGTAATCCCAGG + Intergenic
1061688824 9:132307643-132307665 TTAAGCTTACCAGTCACCACTGG + Intronic
1202796178 9_KI270719v1_random:122172-122194 TAAAACTGACCAGTAATCCCAGG - Intergenic
1186083777 X:5963623-5963645 TGAACCTTTCTAGTAATCCCAGG - Intronic
1188330996 X:28871660-28871682 TACATTTTATCAGTAACCCCAGG + Intronic
1193071555 X:77311166-77311188 TATACCATACCATTATCCCCTGG - Intergenic