ID: 1094661767

View in Genome Browser
Species Human (GRCh38)
Location 12:32476179-32476201
Sequence GACAACAGCTAGAAGACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094661767 Original CRISPR GACAACAGCTAGAAGACTGC TGG (reversed) Intronic
903959841 1:27049919-27049941 GGCAAGAGCAAGAAGGCTGCAGG + Intergenic
910781102 1:90934363-90934385 GAAAACAACTAGAAGAAAGCAGG + Intronic
910850266 1:91643089-91643111 GACAAGATCAAGAAGATTGCTGG + Intergenic
911166573 1:94729913-94729935 GGCAAAAGCCAGAAGACTGGGGG - Intergenic
911904732 1:103552353-103552375 GACCACAGCTTGAAAACTCCTGG + Intronic
912931380 1:113966251-113966273 GACAGCAGCTAGCTGACTGGAGG + Exonic
915057850 1:153152284-153152306 GACTACAGCTAGAAGAATGGGGG - Intergenic
915297612 1:154932400-154932422 GACATCAGCTCCAAGTCTGCAGG + Exonic
916930692 1:169575537-169575559 GAGAACAGATAGAAGACTCCAGG + Intronic
921238717 1:213154549-213154571 GACTACTGCCAGAATACTGCTGG + Intronic
921255600 1:213336406-213336428 TATATCACCTAGAAGACTGCTGG + Intergenic
1063552273 10:7044452-7044474 CACAACAGCTTGTAAACTGCAGG + Intergenic
1063808667 10:9678600-9678622 GACAAAACCTCGAAGACTGTAGG + Intergenic
1064605164 10:17031658-17031680 GTCACCAGATAGAAGAGTGCTGG + Intronic
1064696871 10:17975651-17975673 GACACCAGCCAGAACAATGCTGG - Intronic
1069981539 10:72256050-72256072 GAAAACATCTAGAAGGATGCTGG - Intergenic
1075046934 10:119153809-119153831 AGCAACAGCTAGATGAGTGCTGG - Intronic
1075798471 10:125137197-125137219 GACAACAGGAAGAAGGATGCAGG + Intronic
1076501836 10:130943331-130943353 AAGAACAGCTGGAAGACTACTGG + Intergenic
1076747843 10:132523259-132523281 GACCCCAGCTAGAAGTCAGCAGG - Intergenic
1077515196 11:2997299-2997321 GGCCACAGCTGGGAGACTGCAGG + Intergenic
1078110307 11:8386750-8386772 GGCAAAAGCTAGAGGAATGCAGG + Intergenic
1088318595 11:108532055-108532077 GAGAACAAATGGAAGACTGCAGG - Intronic
1090515764 11:127424851-127424873 GGCAACAGCAAGAAGGCTGTGGG + Intergenic
1094661767 12:32476179-32476201 GACAACAGCTAGAAGACTGCTGG - Intronic
1094746592 12:33351298-33351320 GACAAGATCTAGAAGAATGGTGG - Intergenic
1095556423 12:43511220-43511242 GACAAGAGATTGAAGACAGCGGG - Intronic
1099237491 12:80099112-80099134 GACTAGAGTTAGAAGACTGGGGG + Intergenic
1100146232 12:91681190-91681212 GAGAACAACTAGAATATTGCTGG - Intergenic
1102245130 12:111351076-111351098 GACAACAGCCAGATGAGGGCTGG + Intergenic
1102291981 12:111708335-111708357 GACAAGAGCTAGGAGAGTGGAGG - Intronic
1103178333 12:118884770-118884792 GACAGAAGCAAGAAGAATGCAGG - Intergenic
1105827372 13:24134392-24134414 AACAACAGCAAGAAGTCAGCCGG - Intronic
1105917271 13:24928161-24928183 AAGAGCAGCTAGAGGACTGCTGG - Intergenic
1111021611 13:82458665-82458687 GACACCAGGTATAAGACTCCCGG - Intergenic
1115386972 14:32809201-32809223 GACAACAGCTAGAAGTTTAAGGG + Intronic
1115504604 14:34081107-34081129 GACAGAAGCTTGAAGACAGCAGG + Intronic
1118605416 14:67499452-67499474 GACAATAGGTAGAAGACCACAGG + Intronic
1119668971 14:76504443-76504465 AAGAACAGCTAGAAGACCACTGG + Intergenic
1121631044 14:95422193-95422215 GAGAACAGCTCGCAGACAGCAGG - Intronic
1122468603 14:101950774-101950796 GAGAACAGCAAGAAAGCTGCTGG - Intergenic
1124069286 15:26376565-26376587 GACATCAGCTAGGAGACAGGAGG + Intergenic
1126663333 15:51053324-51053346 GACATCACCTAGAGGTCTGCAGG - Intergenic
1127015436 15:54680962-54680984 GAAAACAGCTAGAAATCTGGAGG + Intergenic
1131952012 15:97691452-97691474 GACACCAGGAAGAAGTCTGCAGG + Intergenic
1133346685 16:5075833-5075855 GACAAGAGCTAGGAGAGTTCCGG - Intronic
1133739985 16:8644110-8644132 GAGAACAGAGAGAAAACTGCTGG - Intronic
1140219592 16:73033880-73033902 GTCAACAGTGAGAAGACTCCAGG + Intronic
1141126539 16:81404585-81404607 GAGGACAGTTAGGAGACTGCTGG - Intergenic
1145900828 17:28489481-28489503 GAAGTCAGCTAGAAGGCTGCGGG + Intronic
1146550474 17:33776552-33776574 GACAACTGCTACAGGGCTGCTGG + Intronic
1147013058 17:37467248-37467270 GACAGCAGCTGGAAGATAGCTGG + Intronic
1148078092 17:44951099-44951121 GACAACAGCCAGATGACAGTGGG + Intergenic
1148644685 17:49212694-49212716 GACACTAGCTAGGAGACTTCTGG - Intronic
1149863154 17:60135501-60135523 GACGACACACAGAAGACTGCGGG + Intergenic
1150469972 17:65428937-65428959 GACCACAGCTGGAGAACTGCTGG + Intergenic
1151488453 17:74417289-74417311 AACAACAACAAAAAGACTGCTGG + Intergenic
1153682464 18:7513426-7513448 GACAGCAGCTAGAAGAATGATGG - Intergenic
1155225019 18:23721772-23721794 GAAATCAGTTAGAAGACTGGTGG - Intronic
1162553785 19:11373991-11374013 GACAGGAGCTGGAAGACTGAAGG - Intergenic
1165644099 19:37418810-37418832 GACACCAGGCAGAAGACTACAGG + Intronic
1166225611 19:41393198-41393220 GAAAACACTTAGAACACTGCGGG + Intronic
1167204366 19:48090582-48090604 TCCAACAGCCAGAAGAGTGCCGG - Intronic
927082852 2:19647716-19647738 GAAAAGAGATAGAAGACTTCAGG + Intergenic
932135749 2:69227195-69227217 GACATCAGCCAGAATACTTCAGG + Intronic
933529215 2:83485027-83485049 GACCACAGCAAGAACACTGGGGG - Intergenic
933833035 2:86225778-86225800 GACACCAGCCAGCAGGCTGCAGG + Intronic
933976772 2:87518417-87518439 GATAACAGACAGAAGGCTGCTGG - Intergenic
934088498 2:88530102-88530124 CCCAATAGCTAGATGACTGCGGG - Intergenic
934771239 2:96908847-96908869 GAAAACACCTTGAAGTCTGCTGG + Intronic
935037524 2:99393341-99393363 GTCAAAAGCTAGAAGTCGGCTGG + Intronic
936317043 2:111432387-111432409 GATAACAGACAGAAGGCTGCTGG + Intergenic
938935395 2:136123303-136123325 GACAACATCTAAAAACCTGCAGG + Intergenic
941610181 2:167652008-167652030 TACAATAGACAGAAGACTGCAGG + Intergenic
946206762 2:218114797-218114819 GAAAACAGTTAGCAGGCTGCAGG - Intergenic
947312428 2:228818717-228818739 GCCCACAGCTAGTAGACTGTAGG - Intergenic
947419739 2:229931427-229931449 GTCAAGAGCTTGCAGACTGCAGG - Intronic
948959327 2:241319892-241319914 GAAAACAGTAAGAAAACTGCTGG - Intronic
1170975309 20:21158673-21158695 GAGAACAGCTAGAGGACTAAAGG + Intronic
1171026705 20:21637406-21637428 GCCTGAAGCTAGAAGACTGCTGG + Intergenic
1172151233 20:32792046-32792068 GCCCACAGATAGAAGACAGCTGG - Intronic
1173298142 20:41777571-41777593 GACAAGAGCAAGAAAACTGGTGG + Intergenic
1173780041 20:45748263-45748285 GACAGCAGATAGAAGAATCCCGG - Intronic
1175592453 20:60203887-60203909 GACAACAGGCAGGAGGCTGCAGG + Intergenic
1182633821 22:31708628-31708650 TTCAACAGCAACAAGACTGCTGG - Intronic
949359848 3:3220177-3220199 GAGAAAAGCTAGAGGACTGGTGG + Intergenic
950507292 3:13403330-13403352 GACAACAGTGGGAAGACAGCAGG - Intronic
951979404 3:28548937-28548959 CACAACACCTACAAGACTGAGGG - Intergenic
952468458 3:33617881-33617903 GACTCCAGGAAGAAGACTGCAGG + Intronic
954432882 3:50480715-50480737 GACCCCAGCTAGAAGGCTGGGGG + Intronic
956113371 3:65893979-65894001 GAAACCAGCTAGGAGGCTGCAGG - Intronic
956526469 3:70168241-70168263 GACAACAGCTAGAAGAAGGCAGG - Intergenic
960629186 3:119711924-119711946 GAGAAAATCTAGAAGACTGTAGG + Intronic
960986195 3:123282612-123282634 AACAACAGCTGGAAGAAAGCAGG + Exonic
961818314 3:129562572-129562594 GACAACAGCAAAAAGCCTTCAGG - Intronic
962160674 3:132996472-132996494 GACACCAGCATGAAGACAGCAGG - Intergenic
964337605 3:155672963-155672985 GACAACAGTTTGGAGACTGATGG - Intronic
964778823 3:160312146-160312168 GGCCACAGCTATATGACTGCAGG + Intronic
964882325 3:161437256-161437278 GAAAAAAGCAAGAAAACTGCTGG + Intergenic
972359803 4:38316317-38316339 GTCAACAGCATGGAGACTGCAGG + Intergenic
974016533 4:56654115-56654137 GACAGCAGCCAGAAGGCAGCAGG - Intronic
974384210 4:61184108-61184130 GACAAGATCTAGAAGACTGAAGG + Intergenic
976968255 4:91072162-91072184 GAGAACTGCTAGAAAACTGGGGG + Intronic
977423494 4:96834655-96834677 GAGAGCAGCAAAAAGACTGCAGG + Intergenic
977828534 4:101562467-101562489 GACAACAGCTATCAGTCTGTAGG + Intronic
986030488 5:3888771-3888793 GAAAACAGCTGGGAGGCTGCTGG - Intergenic
993100297 5:83530322-83530344 GACAACAACAAAAAGACAGCAGG - Intronic
993406129 5:87513608-87513630 GATAACACTTAGAAGGCTGCAGG - Intergenic
995569449 5:113463953-113463975 GAGAACAGCAAGAAGACTGTGGG + Intronic
995727841 5:115201449-115201471 GAAAAGAGCATGAAGACTGCAGG - Intergenic
996782911 5:127207895-127207917 AGCAACAGCTAAAATACTGCTGG - Intergenic
1002294669 5:178223763-178223785 GACAACAGAGGGAAGACTGTTGG - Intronic
1002809932 6:618038-618060 TACAACAGCTACAAGACTTTCGG + Intronic
1005384421 6:25271917-25271939 TACAACAGATAAAAGACTTCAGG + Intergenic
1005565083 6:27083581-27083603 GACCACAGTGAGGAGACTGCTGG - Intergenic
1007335873 6:41154510-41154532 GAAGAAAGCTAGAAGCCTGCAGG + Intergenic
1007820852 6:44559590-44559612 GCCAGCATCTAGAAGACTCCTGG + Intergenic
1012256549 6:97039523-97039545 GAAAATAGCTAGAAGACAGCCGG + Intronic
1018236740 6:161733470-161733492 GATAACAGCCAGAATACTACAGG + Intronic
1018280066 6:162175820-162175842 GACAACAGCCCTTAGACTGCAGG - Intronic
1023209319 7:37786107-37786129 CAACACAGCTAGAAGAATGCAGG - Intronic
1023931173 7:44707567-44707589 GGCGACAGCTAGGAGACAGCAGG - Exonic
1026510611 7:71024428-71024450 GACTACACTTAGAAAACTGCTGG + Intergenic
1034843376 7:154420315-154420337 AACAACAGCTAGAAGAGAGAAGG + Intronic
1036539407 8:9689899-9689921 GACAACAGATAGAGGTCTTCTGG - Intronic
1043043010 8:75285813-75285835 CACATCAGATAGAGGACTGCTGG + Intergenic
1044572489 8:93734806-93734828 GACATCAGCTAGAGGACTTGAGG - Exonic
1044768698 8:95605976-95605998 GAAAGCAGCTGGAAGACTGAAGG - Intergenic
1047957053 8:129984206-129984228 GACAACAGTCAGAGGGCTGCAGG + Intronic
1052345248 9:27402843-27402865 GACAAAAGCCAGCAGACTTCTGG - Intronic
1055936306 9:81607658-81607680 CACAACAGCTACAACACTGCTGG + Intronic
1055936386 9:81608252-81608274 TACAATAGCTACAACACTGCTGG + Intronic
1059733701 9:117081217-117081239 GAGAACAGCTGAGAGACTGCAGG - Intronic
1061909099 9:133713381-133713403 GACAACGGCCACAAGACAGCGGG - Intronic
1186156639 X:6733024-6733046 AACACCAGGTAAAAGACTGCAGG + Intergenic
1189316890 X:40062843-40062865 GACAACAGCGAGAAGCCATCCGG - Exonic
1191840749 X:65512228-65512250 GAGAACAGCAGGAAGCCTGCTGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1194254262 X:91617413-91617435 GGCAACAGCTGGACAACTGCTGG - Intergenic
1195345262 X:103944029-103944051 GGCAAGAGCTAGAAGAATCCAGG + Intronic
1195631904 X:107065080-107065102 GACAACAGCCATAAGAAAGCTGG - Intronic
1196515574 X:116606538-116606560 AAGAACAGCTAGAAGCCTCCAGG - Intergenic
1196707667 X:118729674-118729696 TAAAGCAGCTAGAAAACTGCTGG - Intronic
1198748293 X:139913079-139913101 GACAGCTGCTAGAAGACAGTAGG - Intronic
1198844179 X:140892068-140892090 GAGAACAGCTGGAAGATGGCAGG + Intergenic
1199517927 X:148699719-148699741 CACCACAGCTAGAAAACTGATGG + Intronic
1200573053 Y:4856992-4857014 GGCAACAGCTGGACAACTGCTGG - Intergenic