ID: 1094664601

View in Genome Browser
Species Human (GRCh38)
Location 12:32506615-32506637
Sequence GCAAGGAGGTGCCTGTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 328}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094664601_1094664609 1 Left 1094664601 12:32506615-32506637 CCAACCCACAGGCACCTCCTTGC 0: 1
1: 0
2: 5
3: 36
4: 328
Right 1094664609 12:32506639-32506661 CAGGACCACCCCACCCCCTAAGG 0: 1
1: 0
2: 1
3: 29
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094664601 Original CRISPR GCAAGGAGGTGCCTGTGGGT TGG (reversed) Intronic