ID: 1094672703

View in Genome Browser
Species Human (GRCh38)
Location 12:32586599-32586621
Sequence AAGGGAAAACAGATGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 674
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 616}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094672703 Original CRISPR AAGGGAAAACAGATGGAGCA GGG Intronic
901309895 1:8261317-8261339 AAGAGAAAGCAGATGGCTCAGGG - Intergenic
901387744 1:8922146-8922168 AAGGGGACAGAGCTGGAGCAGGG - Intergenic
901798962 1:11696215-11696237 AAGGGGAGACAGAGGGAGTAAGG - Intronic
902154712 1:14475600-14475622 AAGGGAGAAATGATGGAGCGTGG + Intergenic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902786982 1:18739048-18739070 AAGGGAGGACAGATGGACCTGGG - Intronic
903087780 1:20878700-20878722 AAGAGAAAACAGATGATACATGG + Intronic
903167058 1:21527891-21527913 AAGGAAAAAAAGATTGAGCTGGG - Intronic
904473907 1:30752270-30752292 ATGGGAAAACAGGTCCAGCAGGG - Intronic
905177659 1:36148118-36148140 AAGGGGAAACACATGGACCTTGG - Intronic
905179800 1:36158414-36158436 AAAGGAACTCAGAGGGAGCAGGG - Intronic
905272540 1:36796325-36796347 AAAGGCAGACAGATGGAGCCTGG + Exonic
906232250 1:44173753-44173775 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
906508797 1:46399201-46399223 AAAACAAAACAGATGGAGGAGGG + Intronic
906801917 1:48745436-48745458 AACGGACATCAGAGGGAGCAGGG + Intronic
907454953 1:54569485-54569507 AGGGGAAAACAGAGGGAACAAGG - Intronic
907647914 1:56262725-56262747 AATGAAAGACACATGGAGCAGGG + Intergenic
907953331 1:59204972-59204994 AAGAGAAAACAGCTTGAACATGG - Intergenic
908791066 1:67782107-67782129 AAGGCAAAACAGATGTAAAAGGG + Intronic
909219076 1:72931323-72931345 AAGGGAGAAAGGATGGAACAAGG - Intergenic
909813653 1:79962762-79962784 AAAGGAAAAGAGAAGGAGAAAGG + Intergenic
910043359 1:82881859-82881881 AGGGGAAAACAGATCAAGAATGG - Intergenic
910051504 1:82979267-82979289 TAGGGAACACAGTAGGAGCAAGG - Intergenic
910190583 1:84590921-84590943 AATGGAAAACAGAAGAAGCAGGG + Intergenic
910610493 1:89135981-89136003 AATGGAAAACAAAAAGAGCAGGG + Intronic
910897300 1:92082193-92082215 AAAGAAAAATAGATGTAGCAAGG + Intronic
911620941 1:100065821-100065843 AAGGGAAAAGGAATGGAGAAAGG - Intronic
912713641 1:111966848-111966870 AAGGGTAAACTCATGGGGCATGG + Intronic
912876385 1:113364218-113364240 AAGGGGAGAAAGATGGAACAAGG + Intergenic
912877188 1:113371734-113371756 AAGGGAAAACAGATCACGGAGGG + Intergenic
912887359 1:113488958-113488980 AAGGGAATGCAGCTGGAGCAGGG - Intronic
914838538 1:151228579-151228601 AAGGGAAAACAGAAGCATCCTGG + Intronic
915341598 1:155179535-155179557 AAGGGAAAGCAGCGGGAGCCGGG - Intronic
915367069 1:155322648-155322670 CAGGGAAAATTGATGGAGGATGG + Exonic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
915790252 1:158662007-158662029 GAGGGAAAAGAGATAAAGCATGG - Intronic
915865949 1:159499568-159499590 TAGGAAGAACAGATGGAGAAAGG - Intergenic
916042490 1:160973228-160973250 AAGGGGCAACAGATGAGGCAAGG + Intergenic
916155367 1:161840121-161840143 ATGAGACAACAGATGGAACATGG - Intronic
916291489 1:163171422-163171444 AACTGAAAACAGTTGCAGCATGG - Intronic
916389409 1:164314738-164314760 AAGCGAAAACAGAGGTAGCAGGG + Intergenic
916750402 1:167718500-167718522 AAGGGAAAAGAGAGAGAGCAGGG - Intergenic
916755078 1:167761643-167761665 AATGGAAAGCAGATGGATTAGGG + Intronic
917871881 1:179249368-179249390 AAGGAAGACCAGAGGGAGCATGG + Intergenic
918144260 1:181741990-181742012 AAGAGAAAATGGATGGAGAAGGG - Intronic
918206672 1:182315632-182315654 AACTCAAAACAGATGGAACAGGG + Intergenic
918234810 1:182570340-182570362 AAGGGAAGACAGAGGGGTCAGGG - Intergenic
918337847 1:183538693-183538715 AGAGGATAACAGATGGAGCAAGG - Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920837986 1:209529686-209529708 TGGGGAGAACAGATGGAGCCAGG + Intergenic
921093027 1:211860895-211860917 AAGGATGAACAGGTGGAGCATGG - Intergenic
921599110 1:217088755-217088777 AAGGGAAAAGAAAGGGAGGAGGG + Intronic
921684871 1:218078256-218078278 AAGGGAAAAGAGAGAAAGCACGG + Intergenic
922356721 1:224783306-224783328 GAAGGAAAACAGAAGGGGCAAGG + Intergenic
922695532 1:227729146-227729168 ACAGGAAAACAGCTGGAGCTGGG - Intronic
923153790 1:231258091-231258113 AAGGGAAAATAGAGGAATCAAGG - Intronic
923231039 1:231986674-231986696 AATGTGAAACAGATGAAGCAGGG - Intronic
924304794 1:242676534-242676556 AATGAAAAAAAAATGGAGCAGGG + Intergenic
1062886045 10:1016776-1016798 AAGAGAAAAGAGATGTAACAGGG + Intronic
1062886049 10:1016816-1016838 AAGAGAAAAGAGATGTAACAGGG + Intronic
1062886054 10:1016856-1016878 AAGAGAAAAGAGATGTAACAGGG + Intronic
1062886059 10:1016896-1016918 AAGAGAAAAGAGATGTAACAGGG + Intronic
1062886063 10:1016936-1016958 AAGAGAAAAGAGATGTAACAGGG + Intronic
1063518676 10:6721371-6721393 AAGGGAGCAGAGATGGAGAATGG - Intergenic
1063854458 10:10232544-10232566 AAGGAAAAAAAAATGTAGCAAGG - Intergenic
1063878464 10:10506520-10506542 AAGGGAAAACAGATTGGGGTAGG - Intergenic
1065451362 10:25862111-25862133 AAAGTAAAACTGATGTAGCAGGG + Intergenic
1065638289 10:27753194-27753216 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638307 10:27753272-27753294 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065856382 10:29833584-29833606 AAGGAAAAAAAGATGGATCTTGG + Intergenic
1065968588 10:30788065-30788087 AAGGGAAAAAAGGTGCAGGAGGG - Intergenic
1066021475 10:31307979-31308001 ATGGGAAAACAGATTCAACAAGG + Intergenic
1066405276 10:35112442-35112464 AAGGGAACCCAGACAGAGCATGG + Intergenic
1067071128 10:43132979-43133001 AAGGCACAAAATATGGAGCAAGG - Intergenic
1067460406 10:46454056-46454078 AAGGGAAGAGAGAGGGAGGATGG + Intergenic
1067626786 10:47930547-47930569 AAGGGAAGAGAGAGGGAGGATGG - Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068344074 10:55747975-55747997 ATGGAAAAACAGATAGGGCACGG - Intergenic
1068372306 10:56132499-56132521 AAGGGAAAAAAGAGGAAACAGGG - Intergenic
1068876462 10:62001665-62001687 AAGGGAAGACAGAGAGAGGAAGG + Intronic
1069250943 10:66266064-66266086 AAGGGAAAAGAGAGAGAGGAAGG + Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070973074 10:80583371-80583393 AAAAGACAACAGATGGAGCCGGG + Intronic
1071809569 10:89164726-89164748 AAGGGAAAAGAGTTGGAGCAAGG + Intergenic
1071970756 10:90904419-90904441 TAGGGAGAACAGATGAAGCGAGG - Intronic
1072463260 10:95639771-95639793 GGGGGAAAACTGATGGAGAAGGG - Intronic
1072801186 10:98393432-98393454 AAGGGGAAGCAGCTGGAGAATGG - Intronic
1072997343 10:100257113-100257135 AAGTGAAAATTGATGGAGCAAGG - Intronic
1073140329 10:101242946-101242968 AAGAGAAAACAGCAGGAGCCAGG + Intergenic
1073643444 10:105276042-105276064 CAAGGAAAATACATGGAGCATGG - Intergenic
1074181521 10:111069211-111069233 AAGAGAAAAGAGCTGGAGAAGGG - Intergenic
1074324194 10:112431867-112431889 CACTGAAAACAGATGGAGCTAGG - Intronic
1075258105 10:120940938-120940960 AAGGGAAAACAGAAAGAACAAGG - Intergenic
1075596506 10:123734117-123734139 AAAGGGAAAGAGATGGAGGAAGG - Intronic
1075639319 10:124053378-124053400 AGGGGGAGACAGGTGGAGCAGGG + Intronic
1076020528 10:127069018-127069040 AGAGCAAACCAGATGGAGCAAGG - Intronic
1076088609 10:127658818-127658840 ACGGGAAAACAGATGGACTTTGG - Intergenic
1076598452 10:131640602-131640624 AATGGAAAACAGAAAGAGCAGGG + Intergenic
1076910884 10:133388762-133388784 AAGGAACCACTGATGGAGCAGGG - Intronic
1078707684 11:13760769-13760791 AAGGGGAAAGCAATGGAGCAAGG + Intergenic
1079168704 11:18071209-18071231 AAGGAAAAACAGCTGGAGAGAGG + Intronic
1080291235 11:30673849-30673871 AAGGGATGACAGATGGAACCTGG + Intergenic
1080301689 11:30791629-30791651 CAGGGAAAAGAGATGGGGCTGGG + Intergenic
1080352046 11:31396533-31396555 AAGGGGAAACATAGGAAGCAGGG - Intronic
1081087454 11:38819427-38819449 AAGGGGAAAGAGCTGTAGCAAGG - Intergenic
1082659806 11:55895719-55895741 AAAGGAAAAAAGGTGGAACAGGG - Intergenic
1082897939 11:58213013-58213035 AAGAGAAAACACATGCAGAAGGG - Intergenic
1083619048 11:64039977-64039999 AAGGGAAAACAGAAGAGCCAGGG - Intronic
1086039342 11:82456655-82456677 ATAGGAAAACAGATGGATCTGGG - Intergenic
1086508661 11:87531720-87531742 TAGGGAAAACAAATGGATAAGGG - Intergenic
1087249679 11:95883488-95883510 GAGGGAGAACAAATGAAGCAAGG + Intronic
1088258699 11:107925246-107925268 GAGGGAAAAGAGATGAAGGAAGG + Intronic
1088647380 11:111927596-111927618 AACGGAGAACAGATCGAGAAAGG - Intronic
1088771023 11:113036356-113036378 AAGGGAAAGCTGATGGTTCAGGG - Intronic
1088988120 11:114927938-114927960 AACGGAAGAGAGATGGGGCAGGG + Intergenic
1089314115 11:117579002-117579024 AAAGGAAAACAGAAGAATCAAGG - Intronic
1089483653 11:118828005-118828027 AAGAGAAAACAGGTGGCTCACGG + Intergenic
1089785823 11:120906320-120906342 AGGGGAAAAGAGTTGGATCAAGG - Intronic
1090472135 11:126990058-126990080 AAGGGAAAACGCCTGGAGCGGGG + Intronic
1090695344 11:129235578-129235600 AAGAGAAAACAGGTGGCGCTTGG + Intronic
1091799209 12:3314115-3314137 AACGGAACACAGATGGGGCCAGG - Intergenic
1092113814 12:5984430-5984452 AAGGGAGAGCAGATAGATCAGGG - Intronic
1092296512 12:7203401-7203423 AAGGGAAAGCAGATAGAAAAAGG - Intronic
1092709752 12:11323280-11323302 AAGAGAAACCAGCAGGAGCAAGG + Intergenic
1092815603 12:12310108-12310130 AAAGTGAAACAGATGGAGGAAGG + Intergenic
1092828840 12:12424134-12424156 AAAGGAAAACAGAAAGAGAAAGG - Intronic
1093052806 12:14522148-14522170 GAGGGAGAAGAGATGGAGAAGGG + Intronic
1093234383 12:16588497-16588519 AAGGTAAAACAGGGAGAGCATGG + Intronic
1093853410 12:24068817-24068839 AAGGCAAAAAAGATGCAGAAGGG + Intergenic
1094064922 12:26351976-26351998 AAGGGAAAACATTTGGAATAGGG + Intronic
1094086586 12:26599875-26599897 AAGGAAAAAAAAATGAAGCAAGG + Intronic
1094188609 12:27672736-27672758 AAATGAAAACTGATGAAGCAAGG - Intronic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1094793682 12:33945278-33945300 GAGTGATAACAGATGGATCAGGG + Intergenic
1095232269 12:39753506-39753528 TATGGAAAAGAGATGGAGAAAGG + Intronic
1096267726 12:50137328-50137350 AAGGGAGAACAGAGAGAGCAAGG + Intronic
1096360503 12:50981806-50981828 AAGGAAAAAAAGATGGAAGAGGG + Intronic
1096933234 12:55239357-55239379 AGGGGAAAAGAGATGGAGAATGG + Intergenic
1097614346 12:61865427-61865449 AAAGGAAGAAAGATGGAGGAGGG + Intronic
1097728290 12:63099348-63099370 GAAGGAAAACAGAAGGGGCAAGG + Intergenic
1098347643 12:69523399-69523421 AATGGAAAACAGAAAAAGCAGGG - Intronic
1098771725 12:74560778-74560800 CAGGGAAAACAGAGTGTGCAGGG + Intergenic
1098840470 12:75471530-75471552 AAGGGCAAAGAGAAGCAGCATGG + Intergenic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099646687 12:85366623-85366645 AAAGGAAAATGGATGGAGTATGG - Intergenic
1099830877 12:87840972-87840994 AAGAGAAAACAGAAAAAGCAAGG - Intergenic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1100143246 12:91644451-91644473 AAGGCAAAAAAAGTGGAGCAAGG - Intergenic
1100658346 12:96670843-96670865 AAGAGAAAACAGCTAGAACAAGG - Intronic
1101011276 12:100452556-100452578 AAGGGAAGAAAGATGGAGAATGG + Intergenic
1101089417 12:101270036-101270058 AAAGGAAAACAGAGGGGACAGGG - Intergenic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101923944 12:108955884-108955906 ATGAGAAAACAGATGCAGGAAGG + Intronic
1102304398 12:111793468-111793490 AAGGGGAAACTGGTGGAACAGGG - Intronic
1104045762 12:125161548-125161570 AAGGGAAATCAGGAGGAGAATGG - Intergenic
1104427250 12:128687917-128687939 AAGGGAAAACAGTGTGAGCCGGG - Intronic
1104437968 12:128771029-128771051 AAGGGAAAAAAGGCCGAGCACGG + Intergenic
1104713424 12:131001698-131001720 ACCGGAAGACAGATGGAGCCAGG - Intronic
1105737142 13:23283440-23283462 AATGGAAAAAAGATAAAGCAGGG - Intronic
1106715949 13:32387996-32388018 AAGAGAAAACAGCTGGACCCAGG - Intronic
1107073673 13:36298393-36298415 AAGGAAACACAGATGTATCAAGG - Intergenic
1107165001 13:37273417-37273439 GAAGGAAGACAGATGGAGAAAGG - Intergenic
1107187714 13:37544465-37544487 AATGGAAAACAGAAAAAGCAGGG - Intergenic
1107229569 13:38091831-38091853 AAGGGAAAACAGAGGAAGAAGGG + Intergenic
1107904519 13:45049965-45049987 AAGGGGTAACTGAGGGAGCAAGG - Intergenic
1107962189 13:45568322-45568344 AAGTGAAAACAGATGGAAACTGG - Exonic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1108421895 13:50259220-50259242 AAGAAAAACCAGATGGAGAATGG - Intronic
1109042672 13:57359564-57359586 AAGGATAAATAGTTGGAGCATGG + Intergenic
1109261637 13:60151316-60151338 AAGGGAAAACAGAGGCACAAAGG + Intronic
1109861933 13:68211482-68211504 AAGGAACAAAAGATGGAGAATGG + Intergenic
1110855603 13:80293766-80293788 AAGAGAAAAGAGATTGGGCACGG - Intergenic
1111396353 13:87672947-87672969 AAGGGAAAACGGAGGAAGAAGGG - Intronic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1111752734 13:92355545-92355567 AAGGGGAAAAACAGGGAGCATGG - Intronic
1112575358 13:100630705-100630727 AAAGGAAAACAGCAGGAGCTTGG - Intronic
1112676268 13:101705697-101705719 GAGGGGGAGCAGATGGAGCAAGG + Intronic
1112840546 13:103572255-103572277 AAGGGAAGAGAGGTGGAGGAAGG - Intergenic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113270732 13:108670567-108670589 ATGGGAGAACAAATGGACCAAGG + Intronic
1113649405 13:112025306-112025328 AAAGCAAAAGAGATGGGGCAGGG + Intergenic
1113782347 13:112983841-112983863 CAAGGAAAACAGCTGCAGCACGG - Intronic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1115875517 14:37857394-37857416 AAGGTAAGACAGATTGACCAAGG - Intronic
1116467937 14:45254596-45254618 AAGGAAAAACAGTTGGAGGTAGG + Intergenic
1116782650 14:49252924-49252946 AATGGAAAACAGAGAAAGCAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117010426 14:51465090-51465112 AAGGAAAAACAGATAATGCAAGG + Intergenic
1117246920 14:53895679-53895701 AAAGGAAGACAAATAGAGCAAGG - Intergenic
1117313162 14:54548526-54548548 AGGGGAAAACAGAGGTAACAAGG - Intergenic
1117480496 14:56139208-56139230 AAAGGAAGACAGATGGGCCAAGG + Intronic
1117761415 14:59032734-59032756 AAGGAAGAACAGTTGGAGCTGGG - Intergenic
1117837576 14:59823335-59823357 AAGGGAAACGAGAAAGAGCAGGG - Intronic
1118099587 14:62581557-62581579 AAGGGATAACATATGAGGCAAGG - Intergenic
1118280668 14:64425499-64425521 AAGGGAAAACAGGCCGGGCACGG - Intronic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118348055 14:64954078-64954100 AAGGGAAAAAAGATGCAGAACGG + Intronic
1118361587 14:65061844-65061866 AAGGGAAAAGAGCTGGAGGTGGG + Exonic
1119995398 14:79248233-79248255 AAGGGAGAGCAGATGAAGAAGGG - Intronic
1120019362 14:79510897-79510919 ATGGGAATACAGATGAGGCAGGG - Intronic
1120145349 14:80972967-80972989 AAGGGAAAACAGATGTAAACAGG + Intronic
1120611285 14:86645249-86645271 ATGGGAAAATTGATGGAGAAAGG - Intergenic
1120625926 14:86826432-86826454 AAGGAAAAACTGATGGTGCAGGG + Intergenic
1120645705 14:87071521-87071543 TGGGGAACACAGATGGAGTAGGG + Intergenic
1120684070 14:87517575-87517597 AAGAGAAGACAGATTGTGCAGGG + Intergenic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1120827511 14:88969058-88969080 AAGGGGAAACAGCAGGAACAAGG - Intergenic
1121032758 14:90673430-90673452 AAGAGAAAAAAGAAGGAGCGCGG + Intronic
1121435706 14:93917846-93917868 AAGGGAAAAGTGATGGGGCAGGG - Intergenic
1122110620 14:99498398-99498420 AAAGGAAAACACCTGGAGCTGGG + Intronic
1122253889 14:100462910-100462932 AAGGGAAAAAGGAAGGAGCGGGG - Intronic
1122253907 14:100462965-100462987 AAGGGAAAAAGGAAGGAGCAAGG - Intronic
1122253923 14:100463020-100463042 AAGGGAAAAAGGAAGGAGCAAGG - Intronic
1122330220 14:100906903-100906925 AAGGGAAATCAGATGTCGCTGGG - Intergenic
1124351137 15:28956328-28956350 GAGGGAAAACAGATGGGGTGGGG + Intronic
1124449493 15:29773095-29773117 AAGGAAAAATATATGAAGCATGG + Intronic
1124608756 15:31193266-31193288 GAGGGAAAGCAGATGGAAGAGGG - Intergenic
1124774711 15:32576976-32576998 AAGGAAAAAAAGGTGGGGCATGG - Intergenic
1125442063 15:39713821-39713843 CAGTGAAAACAGCTGGAGCCAGG + Intronic
1125881210 15:43197685-43197707 AAGGAACAACAGATGTAGCTTGG - Intronic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126512719 15:49498789-49498811 AATGGAAAACAAAAAGAGCAAGG + Intronic
1126525887 15:49653880-49653902 AAGGAAAAATAGATGGAAGATGG + Exonic
1126561255 15:50046751-50046773 AAGGAAAAACATATGAATCAAGG - Intronic
1126882744 15:53116929-53116951 AAGGGAAGAAAGAAAGAGCAAGG - Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1128379853 15:67104579-67104601 ATGGGAAAACAGCTGGAAAAAGG - Intronic
1128609128 15:69059846-69059868 AAGAGAAGAGAGAAGGAGCAAGG + Intronic
1129468135 15:75735474-75735496 AAGGGAAAACAGCTGGGCCCAGG - Intergenic
1129478174 15:75801805-75801827 ATGCGAAAACAGATGTTGCATGG + Intergenic
1129506877 15:76088801-76088823 AAGGGAAAAAAGGCGGGGCATGG + Intronic
1131038219 15:89239649-89239671 AAGGGAACACAGAAGCATCAGGG - Intergenic
1131811887 15:96181403-96181425 AAGGTAAATAAGATGTAGCAAGG - Intergenic
1131849182 15:96519767-96519789 GAGGGAGAAGAGATGGAGAATGG + Intergenic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1132932308 16:2464890-2464912 GAGAGAAAACAGAGGGAGCCAGG - Exonic
1134033133 16:11008599-11008621 AAGGAAAAAAAAAGGGAGCAGGG - Intronic
1134718963 16:16370596-16370618 AAGGGGAGAGAGATGGAGAAAGG - Intergenic
1135148677 16:19986246-19986268 AAGGGCCAACAGCTGGAGCCTGG - Intergenic
1135186057 16:20316902-20316924 AAGGGAAGAGAGAGGGAGAAAGG - Intronic
1135795971 16:25442858-25442880 AAGGGAAAGGAGAAGGAGAAGGG - Intergenic
1136060889 16:27725706-27725728 AAAGGCAAACAGATGGACCATGG - Intronic
1137387975 16:48058390-48058412 CAGGGAAAACACATAGAGAAAGG - Intergenic
1137824935 16:51484809-51484831 ATGGGAAAACAGAGAGAGAAAGG - Intergenic
1137951023 16:52783463-52783485 AAGGGAAGACAGAAGCAACATGG - Intergenic
1138074177 16:54024656-54024678 ATGGGAAAACCGAGGGAGAATGG - Intronic
1138418929 16:56886798-56886820 AAGGGAAAACACAAGGAGTGGGG - Intronic
1140022225 16:71249325-71249347 AAGGGAAAACAGATGCAGAGAGG - Intergenic
1140228544 16:73098356-73098378 AAGACAAAACAGGTGGGGCACGG - Intergenic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140423617 16:74842020-74842042 AAGAGAACACAGATGAAACAAGG + Intergenic
1140499465 16:75421239-75421261 AAGGGAAAAAAGGGGGAACAGGG - Intronic
1140671131 16:77280066-77280088 AAGGTAAAACAGACAAAGCATGG + Intronic
1141119591 16:81341951-81341973 AATGGAAAGCAGAAGAAGCAGGG + Intronic
1142786964 17:2231899-2231921 AGAGGAAAACAGAGGGAGCCAGG + Intronic
1143253602 17:5539887-5539909 AAGAGAAAACAGATAGACCCAGG - Intronic
1144490031 17:15700424-15700446 AAGGGAAAACGGTTGGCTCAGGG + Intronic
1144910930 17:18681535-18681557 AAGGGAAAACGGTTGGCTCAGGG - Intronic
1146453713 17:32993857-32993879 GAGGGACAACGGATGGAGCAAGG + Intronic
1147549185 17:41426675-41426697 GAGGGAAACCAGAAGGACCATGG + Intergenic
1147866278 17:43554714-43554736 AAGGGAAAACTGATGGAGGGGGG + Intronic
1147890048 17:43710781-43710803 AAGGGCAAAGAGAGGGAGAAAGG + Intergenic
1147991600 17:44337271-44337293 AAGAGAAAACAGCTGGACCCTGG + Intergenic
1148731612 17:49840129-49840151 AAGGGAGAGCAGAGGGAGAATGG - Intronic
1149239196 17:54629217-54629239 AAGAAAAAAAAGAGGGAGCAGGG - Intergenic
1149441034 17:56674005-56674027 ATGGTAAGAAAGATGGAGCACGG + Intergenic
1149629933 17:58114346-58114368 AAGGGAACCCAGGTGGAGCCAGG - Intergenic
1149773390 17:59339038-59339060 AAGCAAAAACAGAAAGAGCAAGG - Intronic
1151006960 17:70448959-70448981 AAGAGAAGAGAGATGGTGCAGGG + Intergenic
1152092235 17:78253331-78253353 AATGGAAAATAGATGTAGAAAGG - Intergenic
1152358954 17:79821353-79821375 AAGGGAAAAATGATGTAGGAGGG - Intergenic
1152975956 18:218492-218514 AAGGGCAAACAGAAGAACCATGG + Intronic
1153279501 18:3401070-3401092 GATGGAAAACAGATGGCCCAAGG + Intergenic
1154224890 18:12494399-12494421 ATGGTAGAACAGAAGGAGCATGG - Intronic
1157453146 18:47802788-47802810 GAGGGAAGACAGTTGGAGAAAGG + Intergenic
1158323452 18:56289054-56289076 AAGGATAAACAGATGGGTCAAGG + Intergenic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158453601 18:57587641-57587663 AAGGTAAAAGAGATGGGGTAGGG + Intergenic
1158556815 18:58482114-58482136 AAGGGAAAACTAATGGTGCATGG + Intronic
1158660019 18:59378680-59378702 AAAGGAAAACAGAACCAGCACGG + Intergenic
1159529619 18:69639142-69639164 TAGGAAAAACAGATGAACCAAGG + Intronic
1159583427 18:70260768-70260790 AAGGGAAAACAGATGGAAAGTGG + Intergenic
1160406134 18:78647433-78647455 CGGGGACCACAGATGGAGCAGGG - Intergenic
1160786337 19:901659-901681 TGGGGAAGACAGTTGGAGCATGG - Intronic
1160898722 19:1415990-1416012 TAGGGAAAAAAGAAGGAACAGGG + Intronic
1160920783 19:1519382-1519404 ATGGGAAAACATCAGGAGCAGGG + Intergenic
1161412941 19:4126954-4126976 TAGGCAAAACAGAAGGAACATGG - Intergenic
1163504496 19:17697411-17697433 AAGAGAAGACAGAAGCAGCATGG - Intergenic
1164529672 19:29038809-29038831 AGGGGAAAAAGGATGGACCATGG + Intergenic
1165374336 19:35431249-35431271 GAGGGAAAACACATGGTGCAGGG - Intergenic
1165413367 19:35676033-35676055 ATGGATAGACAGATGGAGCAGGG - Intronic
1165438676 19:35811555-35811577 AAAGAAAAAAAGATGGAGTAGGG + Intronic
1165561560 19:36684976-36684998 AGGGGAAAACAGATGTAAAAAGG + Intergenic
1165604948 19:37093817-37093839 GAGGTAGAACAGATGGAGAATGG + Intronic
1166094022 19:40528630-40528652 ACGAGAAAAGAGATGGAGCAAGG - Intronic
1167640439 19:50678728-50678750 AAGGGAAAACGGAGGGGTCAGGG + Intronic
1168271874 19:55254557-55254579 AAGGGGTGACAGATGAAGCATGG - Intronic
926384526 2:12323295-12323317 AATGGAAAAAAAAAGGAGCAGGG - Intergenic
926527378 2:13997959-13997981 AAGGGAAAATGGAGGGAGAAAGG + Intergenic
927075774 2:19575837-19575859 AATGGAAACCAGATGTTGCATGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927497552 2:23561032-23561054 ACTGGAAAACAGTTGGAGAATGG + Intronic
927647097 2:24884832-24884854 AAGGGAAAAAAGATGGTAAAAGG - Intronic
927848380 2:26483744-26483766 AAGGGACAGCTGAGGGAGCAAGG + Intronic
928334497 2:30384787-30384809 AAGGGAAATCAGATGGAAAAGGG + Intergenic
928694124 2:33831809-33831831 AAGGGAAGACAAAAGGAGCAGGG + Intergenic
928953697 2:36839229-36839251 GAGGGAAAAAAAATAGAGCAGGG - Intergenic
930571721 2:53094516-53094538 AGGAGAAAAGAGATGGAGAAGGG + Intergenic
930786295 2:55274473-55274495 AAGGAAAAAAAGATGGAGAGAGG + Intergenic
930982835 2:57548117-57548139 AAGGGAAAAAAGAGGAAGGAAGG + Intergenic
931650354 2:64462867-64462889 CAGGGAAAATCGATGGAGCTAGG + Intergenic
933628830 2:84633427-84633449 AAGGGAGAACAGAGAGAGGAAGG + Intronic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
935110673 2:100091776-100091798 ATGGGCAAACTGATGGAGGAAGG - Intronic
935181426 2:100694145-100694167 AAAGCAAAACAACTGGAGCAAGG + Intergenic
935322814 2:101905652-101905674 AAGGGAAAACACCTGGGGCTGGG + Intergenic
935947933 2:108302945-108302967 AAGAGCCAAGAGATGGAGCACGG + Intronic
936124298 2:109773386-109773408 ATGGGCAAACTGATGGAGGAAGG + Intergenic
936220391 2:110598078-110598100 ATGGGCAAACTGATGGAGGAAGG - Intergenic
936264533 2:110992635-110992657 GAGGTAAGGCAGATGGAGCATGG + Intronic
936719407 2:115232523-115232545 AAGGGAAATCAGAAGGCACAAGG - Intronic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937995230 2:127689508-127689530 GAAGGAAAAGAGAAGGAGCAGGG + Intergenic
938563328 2:132494397-132494419 ATGAGAAAACAGAAGGAACAAGG - Intronic
939303162 2:140373939-140373961 AAAGGAAAAGAGATGGAGAGAGG - Intronic
939865816 2:147471300-147471322 AAGGGAACACACAGGAAGCAAGG + Intergenic
940029334 2:149244313-149244335 AAGGGAAGAAAGAGGGAGGAGGG - Intergenic
940272526 2:151907168-151907190 TAGGGAAAACAGAACAAGCAAGG + Intronic
940405133 2:153292700-153292722 CAGGGAAAAGAGATGGAACCAGG + Intergenic
941266972 2:163374533-163374555 AAGCCAACACAGATGGAGTAGGG + Intergenic
941984108 2:171492473-171492495 AAAAAAAAAAAGATGGAGCACGG + Intergenic
942929492 2:181472794-181472816 AGGGGAAAACAGAGGGAAGATGG - Intronic
942943911 2:181652667-181652689 AAGTGAAAACAGCTGCAGAATGG + Intronic
943169830 2:184384656-184384678 ATGTGAGAACAGATGGAGAACGG - Intergenic
943794321 2:191972535-191972557 AAGGGGACACAGAGGAAGCAGGG + Intronic
944097497 2:195985422-195985444 AAGGGATAACTGAAGGAGCCAGG + Intronic
944928935 2:204496192-204496214 GAGATAAAAGAGATGGAGCAGGG - Intergenic
946170610 2:217893128-217893150 AAGGGAGAACATAAGGAGGAAGG + Intronic
946359107 2:219208365-219208387 AAGGGGAAAAAGGGGGAGCAGGG - Intronic
946707795 2:222475831-222475853 AAGGGCACACAGATGGGGCCTGG - Intronic
946826187 2:223680618-223680640 AAGAGAAAATAGACTGAGCATGG + Intergenic
947128394 2:226895871-226895893 AAGGGAAAAGACACCGAGCAAGG - Intronic
947376513 2:229502157-229502179 AAGGAAACCCATATGGAGCATGG + Intronic
947520537 2:230842665-230842687 GAAGGAAAACAGGTGGGGCAAGG - Intergenic
947862899 2:233374992-233375014 ACTTGAAAACAGATGGAGCCGGG + Intronic
948191360 2:236061905-236061927 AAAGGAAAACAGATGAGCCAGGG + Intronic
948259805 2:236595233-236595255 GAGAAAAAACAGATGCAGCACGG + Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1170010835 20:11721896-11721918 AAGCAAAAGCAGATGGAACAAGG + Intergenic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171483988 20:25474400-25474422 AAGGAAGAACAGACGGACCAAGG + Intronic
1171720486 20:28557600-28557622 CAGGGAATACAGATTGTGCATGG - Intergenic
1171784803 20:29453049-29453071 CAGGGAATACAGATTGTGCATGG - Intergenic
1171863585 20:30424590-30424612 CAGGGAATACAGATTGTGCATGG + Intergenic
1172064426 20:32208908-32208930 AAGGGAAAATAAAGAGAGCAGGG + Intronic
1172479027 20:35260203-35260225 AGGGGGAGACAGAGGGAGCAGGG - Intronic
1172837946 20:37885029-37885051 AAGGGAAAAAGCATGGAGGAAGG - Intergenic
1173047987 20:39530987-39531009 AAGGGAAAAAGGATGGAGGGAGG - Intergenic
1173411023 20:42809405-42809427 AAGGGCACTGAGATGGAGCAGGG + Intronic
1173735166 20:45355770-45355792 ATGAGAAAACAGGCGGAGCAAGG + Intergenic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174082136 20:47978107-47978129 CAGGGCTAACAGATGAAGCATGG - Intergenic
1174134345 20:48368678-48368700 CAGGGCTAACAGATGAAGCATGG + Intergenic
1175349479 20:58308718-58308740 ATGGGATAAGAGATGGAGCCGGG + Intergenic
1175507970 20:59499793-59499815 AAGGGAAGACAGAGAGAACAAGG + Intergenic
1175605197 20:60307091-60307113 AAAGCAAACCAGAGGGAGCAGGG + Intergenic
1175820360 20:61905801-61905823 AAGGGAATTCAGAAGGTGCAGGG + Intronic
1176659013 21:9616345-9616367 AATGGAGAGCAGATAGAGCAAGG + Intergenic
1177059619 21:16354507-16354529 AAATGAAAACAGATGGTACAGGG - Intergenic
1177604823 21:23364198-23364220 AGGGAAAAACAGGAGGAGCAGGG + Intergenic
1178711082 21:34917280-34917302 AAGAGAAAGCAGATGGAGACAGG + Intronic
1179101686 21:38360013-38360035 ATGGGAAAGCCTATGGAGCAGGG + Intergenic
1179251281 21:39673603-39673625 AAGGGAAAAAAGAGAGAGAAAGG - Intergenic
1180757307 22:18170966-18170988 AAGGGAAAACAGAAAGGACATGG - Intronic
1181074472 22:20366499-20366521 AAGGGAAAACAGAAAGGACATGG + Intronic
1181099585 22:20530534-20530556 ATGGGAAAGCAGTTGGACCAGGG + Intronic
1181392418 22:22593432-22593454 TAGGGGGAACAGATGGAGCAGGG + Intergenic
1181458200 22:23071177-23071199 AAGGGAAAAAATATTGAGCCGGG - Intronic
1181975064 22:26723054-26723076 AAGGGGAAATGGATGGAGGAGGG - Intergenic
1182385168 22:29932868-29932890 CAGGGAAAAAATATGGAGAAAGG - Intronic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1182780427 22:32863177-32863199 AAGGGAAAAGGACTGGAGCAGGG - Intronic
1183239653 22:36647816-36647838 AAGGAAAAACACAGGGAGCTAGG - Intronic
1183604280 22:38859644-38859666 AGGGGCAAACAGATGGGGCTGGG + Intergenic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1184920565 22:47602855-47602877 AAGAGAAAAGTGACGGAGCAAGG - Intergenic
949131686 3:509940-509962 AAGGGAAAACAGAAAAAGCAGGG - Intergenic
949237414 3:1826652-1826674 CAGGGAAAACACATAGAACAGGG - Intergenic
949369290 3:3317522-3317544 AAGAGAAGACAGATTGTGCAGGG + Intergenic
950198046 3:11023216-11023238 AAGGGAGAAAAGGTGGAGTAAGG - Intronic
950617368 3:14171878-14171900 AAAGGAGAAGAGATGGATCATGG + Intronic
950837605 3:15935774-15935796 AAAAGGAAACAGAGGGAGCAAGG - Intergenic
952095745 3:29950947-29950969 AAGGGAAAATAGATTAAGCTGGG - Intronic
952539797 3:34356017-34356039 AAATGGAAACAGATGGAGAATGG + Intergenic
952877881 3:37962436-37962458 AAGAGAGAAAAGATGGAGAAGGG - Intronic
953153077 3:40343103-40343125 AATGGAAAACAAAAGAAGCAGGG - Intergenic
953231079 3:41065571-41065593 AAGGAAAACAAGATGGGGCAGGG - Intergenic
953569533 3:44060081-44060103 AAGTGAAAAGAGAGGCAGCAAGG - Intergenic
953779431 3:45853643-45853665 AAGGGATAATTGATGGAGCTTGG - Intronic
954758918 3:52860257-52860279 GAGGAATAACATATGGAGCATGG + Intronic
955244807 3:57214890-57214912 AAGGGAATATAGATGAAGGAGGG + Intronic
955856297 3:63277607-63277629 AGTGGAAAACAGATTTAGCAAGG - Intronic
956180836 3:66517069-66517091 AAGGGAAAATAGTGGGTGCAGGG + Intergenic
956289690 3:67648402-67648424 AAGGGCAAAAAGATGGGGAAAGG + Intronic
956690537 3:71874240-71874262 AAGGATAAATAGGTGGAGCACGG + Intergenic
957184616 3:76925661-76925683 AAGGGAACACAGATGGGGTCAGG + Intronic
957593760 3:82233830-82233852 AAAAGAAAAGAGATGGAGGAAGG + Intergenic
957636649 3:82794086-82794108 AAGTGAAAACAGGAGAAGCAAGG + Intergenic
957668093 3:83262670-83262692 AAGATAAAACTGAGGGAGCAGGG - Intergenic
957990247 3:87617761-87617783 AAGCGAAAAGTGATGTAGCAGGG - Intergenic
958446147 3:94217501-94217523 AATTGAAAACAGAAGAAGCAGGG + Intergenic
959970245 3:112400923-112400945 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
960165187 3:114393506-114393528 AGGGGAAAGAAGATGGAGCTAGG - Intronic
960169968 3:114448452-114448474 GAGGGCAAACAGATGGATCAAGG + Intronic
961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG + Intergenic
961546649 3:127639013-127639035 AAGGGGAGACAGATGGAGACAGG - Intronic
961678638 3:128583949-128583971 CAGGGAAAAAGGATGTAGCAAGG - Intergenic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
962317596 3:134368493-134368515 AAGGTTAAACAGCTGGAGCAGGG - Intronic
963161216 3:142152214-142152236 ATGGGAAAACAGTTGGAGATGGG - Intergenic
963224764 3:142851041-142851063 AAGGGAAGACAGATGTAGGTAGG + Intronic
963244917 3:143048888-143048910 AAGTGAAAATAGATGGAAAAAGG + Intronic
963299081 3:143578846-143578868 AGGGGAAAACAGATACAGAAGGG + Intronic
963306197 3:143656007-143656029 ATGAGAAAACTGCTGGAGCAAGG + Intronic
963317111 3:143771710-143771732 GAGGGACAACAGCAGGAGCACGG - Intronic
963561283 3:146869149-146869171 AAGGGGAGAGAGAGGGAGCAGGG - Intergenic
964602924 3:158522720-158522742 CAGGGAAAAAAAATGAAGCATGG - Intronic
965352141 3:167626791-167626813 GAGGGAAAACTTATGGGGCAGGG - Intronic
966142942 3:176776873-176776895 AAGAGAGAACAGATGTAGCTGGG - Intergenic
966542780 3:181110351-181110373 AAAGGAAAACATATTGAGTAGGG + Intergenic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
966977667 3:185099880-185099902 AATGGAAAACAGAAAAAGCAGGG + Intronic
967492832 3:190113224-190113246 AAGGGAAAGCAAATGGAGCTTGG - Intronic
967712392 3:192724016-192724038 AAGGGAAAAGGGAGGGAGAAAGG + Intronic
967934610 3:194716849-194716871 AAGGGGAAACAGAAGTACCAAGG + Intergenic
968301008 3:197614628-197614650 AAGAGAAAATAGGTGGAGGAAGG + Intergenic
969030301 4:4206748-4206770 GTGGGAAAACAGATTCAGCAAGG - Intronic
969690495 4:8701552-8701574 GAGGGAAAACAGGAGGAGCTGGG + Intergenic
971011835 4:22446502-22446524 AAGAGAAACAAGATGGAGTATGG + Intronic
973139541 4:46749404-46749426 TTGGGAAAATAGATGGAGGATGG - Intronic
974076124 4:57170153-57170175 GAGGTCAAACTGATGGAGCATGG + Intergenic
974927363 4:68316796-68316818 AAGGGAAAACTGAAGCAACAAGG + Intronic
974938788 4:68439141-68439163 ATGGGAAAACAGATGAAGAAAGG + Intergenic
976408235 4:84683586-84683608 TAGGGAAAACATAGTGAGCAGGG - Intronic
976870281 4:89784193-89784215 AATAGAAAACAGATGAAGAAAGG + Intronic
977354847 4:95932802-95932824 AAGAGAAAATAGGGGGAGCAAGG - Intergenic
978016236 4:103749833-103749855 GAAGGAAAACAGGAGGAGCAGGG - Intergenic
978465464 4:109004082-109004104 AAGGGAAATGAGATGGTGAAAGG - Intronic
978479912 4:109177158-109177180 AAGACAAAAAAGATGGAACATGG + Intronic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
978542351 4:109831616-109831638 ATAGGAAAAGAGAAGGAGCAGGG + Intronic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
979639075 4:122990877-122990899 AAGGGAAAACAGGTCCAGCATGG - Intronic
981215259 4:142158031-142158053 AGGTGATAACTGATGGAGCAAGG - Intronic
982079182 4:151770857-151770879 AAGGAAAAAAAGAAGGATCAAGG + Intergenic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982566416 4:156992501-156992523 AGGGGAAAGCAAAAGGAGCAAGG + Intergenic
982718759 4:158837853-158837875 AAGGGAGCACAGATGGTGGAGGG + Intronic
982837094 4:160132358-160132380 TAGGGAGAAAAGATGGAGAAAGG + Intergenic
983731162 4:170995382-170995404 AAAAGGAAACAGATGGATCATGG - Intergenic
984038136 4:174693905-174693927 AACGGAAAACAGAAAAAGCAAGG + Intronic
984258131 4:177411398-177411420 AAGGGGAAAGAGATGGACCTGGG - Intergenic
984376271 4:178934675-178934697 AAGGGAAATGAGAAGGAGAAAGG - Intergenic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985416313 4:189739088-189739110 AATGGAGAGCAGATAGAGCAAGG - Intergenic
986750743 5:10785412-10785434 CAGGGGAAACAGATAGAACAGGG + Intergenic
986775428 5:11009401-11009423 GAGGGAGAAGAGATGGAGCTGGG + Intronic
987244019 5:16029937-16029959 AATAGAAAACAGATGGAGTTTGG - Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
989069647 5:37497233-37497255 AAGGGAAAAGGGAGGGAGGAGGG - Intronic
989200860 5:38761915-38761937 AAGGGACAACACATGGCACATGG + Intergenic
989333035 5:40281962-40281984 AAGGGAGAAGAGATGGGGCTAGG - Intergenic
989665227 5:43846301-43846323 AAGGAAAAAGAGAGGGAGGAAGG - Intergenic
989693043 5:44168842-44168864 AATGGAAAACAAAAAGAGCAGGG - Intergenic
989781456 5:45269907-45269929 AAGGGAAAGTAGAGGGAACATGG - Intronic
990426070 5:55690438-55690460 AAGGGAAAGAGGATGGAGAAGGG + Intronic
990763402 5:59155693-59155715 AAAGGAAAACAGACGAAGCAAGG + Intronic
991037263 5:62140366-62140388 AAAGGACAACAGATGGAACCAGG + Intergenic
991247791 5:64526190-64526212 AAAGGAAAACAGGAGGGGCAAGG + Intronic
993649930 5:90508021-90508043 AAGGGAAAATAGGTAGAGAATGG - Intronic
994412820 5:99431039-99431061 AAGGGAAATCAGCAGGAGAACGG - Intergenic
994481021 5:100334681-100334703 AAGGGAAATCAGCAGGAGAACGG + Intergenic
995671949 5:114615068-114615090 AAGAGAAAACTGATGGGGGAGGG + Intergenic
995731689 5:115250353-115250375 AAGAGAAAAAAGTTGGAGAAGGG + Intronic
996306263 5:122051580-122051602 AATGGAAAACAGAAAAAGCAGGG - Intronic
996549139 5:124711940-124711962 ATGGGAAAACAGATGAGACAGGG + Intronic
996606404 5:125328590-125328612 AAAGGAAAAAACATGGACCAGGG - Intergenic
997334843 5:133099951-133099973 CAGGGAATGCAGCTGGAGCAGGG + Intronic
998516873 5:142763835-142763857 ATGGGAAAACAGAGGGAGCCAGG - Intergenic
998549486 5:143063663-143063685 AAAGGTAAAAGGATGGAGCAGGG - Intronic
998585051 5:143418706-143418728 AAGGGTAAACAGTTGGTGCTGGG + Intronic
998855152 5:146387543-146387565 AAGAGAAAACAGATGGAGATGGG - Intergenic
998906323 5:146909028-146909050 AAGAGAAAGCAGATGGTCCATGG + Intronic
999521990 5:152360094-152360116 TAGGGAAAATTGAGGGAGCAGGG + Intergenic
1000109607 5:158095227-158095249 ATAGGAAAACTGATGGAGAAAGG - Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000391352 5:160726621-160726643 AAAGGGAAACAGAGAGAGCAAGG + Intronic
1000591273 5:163160628-163160650 AAGGATGAACAGGTGGAGCATGG + Intergenic
1000858991 5:166433846-166433868 AAGGGAAAAAAAATGAAGTAAGG - Intergenic
1000969323 5:167696608-167696630 TAGGAAAAACAGATGGTGAAAGG + Intronic
1002593428 5:180306533-180306555 AAGAGAAAGCTGATGGGGCAGGG - Intronic
1002917171 6:1538659-1538681 AGGGGAAGAAAGATGGAGAAGGG + Intergenic
1004332098 6:14731193-14731215 AAGGGAATACAGAGGGAGACAGG - Intergenic
1004585242 6:16993349-16993371 AAAGGAAAACAGATAGAAAAGGG + Intergenic
1004617408 6:17303605-17303627 AAGGGAAAAGGGAAGGAGAAGGG + Intergenic
1004673943 6:17823437-17823459 AAGGAAAAAGAGAGGGAGGAAGG - Intronic
1004758567 6:18640801-18640823 AAGGGAACAGAGATAGAGGAAGG - Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005106717 6:22231741-22231763 AAGGGAAATAAGGTGGGGCAGGG + Intergenic
1005136258 6:22571519-22571541 AAGAGACAATAGATGGAGAAAGG - Exonic
1005378816 6:25213143-25213165 AAGTGAGAACACATGGAGGAAGG + Intergenic
1005569678 6:27132781-27132803 AAGGAAAAACAGCGTGAGCAGGG + Intergenic
1005704361 6:28436718-28436740 AAAGGGAAACAAATGGAGGATGG + Intronic
1005717427 6:28563961-28563983 AAAGGCCAACAGATGGAGGAAGG + Intergenic
1006435568 6:34024301-34024323 AAGGGAAAAGAGAAGACGCATGG - Intronic
1006653965 6:35574442-35574464 ACGGGTAAACAGATTGAGCATGG - Exonic
1007291825 6:40793365-40793387 ATTAGAAAGCAGATGGAGCAGGG + Intergenic
1008404703 6:51105772-51105794 AAGGGAAAACAGAGGGTGGGTGG + Intergenic
1009684058 6:66933911-66933933 AATCGAAAACTGATGAAGCAGGG - Intergenic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1009816737 6:68746859-68746881 AAGGGAAAGCAAATGGACTATGG - Intronic
1009917789 6:70017618-70017640 AAGGGAAAACATAAGAAGCTGGG + Intronic
1010571701 6:77481038-77481060 AAGGAAAGAGGGATGGAGCATGG + Intergenic
1011597016 6:89025814-89025836 AAAGGAAAACTGAAGGAGAAGGG - Intergenic
1011982427 6:93398596-93398618 AAAAGAAATCAGATGGAACAGGG + Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012439189 6:99246631-99246653 AAGGAAAAAGGGAGGGAGCAAGG - Intergenic
1012527099 6:100191065-100191087 ATTGGAAAAAAGATGGAACAGGG + Intergenic
1012764693 6:103351932-103351954 AAAGGAAAACAAATGAAGAAAGG - Intergenic
1012848262 6:104417219-104417241 AAAGGAAAAGAGATGGAGGTAGG - Intergenic
1012863710 6:104593010-104593032 AAGGGAAAACATCTGGAACTAGG - Intergenic
1012984228 6:105857836-105857858 AAAGGAAAACAGATGGAAATAGG - Intergenic
1013121421 6:107144578-107144600 AAAAGAAAAAAGATGGATCATGG + Intergenic
1013153257 6:107467356-107467378 AAGGGGAAAGGGATGGAGAAAGG - Intergenic
1013505234 6:110793664-110793686 AAGGGAAAACAGGTTGTGAATGG - Intronic
1014480181 6:121926635-121926657 AAGGGAAAATGGATGGATCTTGG - Intergenic
1014737509 6:125111649-125111671 AAGGAAGAAGAGATGGAGAAAGG - Intergenic
1014884637 6:126764791-126764813 AGGGGAGAACAGATGGAAGAGGG + Intergenic
1015392998 6:132703879-132703901 AATGGAAAACAAAAGGAGCAGGG + Intronic
1015637761 6:135295713-135295735 AAGGGAAGAAAGATGTAGGAGGG + Intronic
1016644095 6:146384062-146384084 GAGAGAAAACAAATGGAGCTTGG + Intronic
1017293414 6:152767430-152767452 AAGGCAAAAGAGAAGGACCAAGG - Intergenic
1017401533 6:154069950-154069972 AAGGAAAAACAAATGAAGTAGGG + Intronic
1018036924 6:159889572-159889594 AAGGCAGAAAAGAAGGAGCACGG - Intergenic
1018757966 6:166865908-166865930 AAGGAAAGACGGATGGAGAAGGG + Intronic
1020904264 7:14045390-14045412 AAGGGAAAATAACTTGAGCATGG - Intergenic
1021281694 7:18727693-18727715 GAGGTAAAACAGAGGCAGCAGGG - Exonic
1021604312 7:22394997-22395019 GAAGGAAAACAGGTGGGGCAAGG - Intergenic
1021638036 7:22710622-22710644 AAGGGAAAACAGAATGAAAAGGG + Intergenic
1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG + Intergenic
1022857495 7:34329802-34329824 GAGGGAATACACATGGAGCATGG + Intergenic
1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG + Intronic
1023335539 7:39165234-39165256 AAGGGTTAACAGATGAAGGAGGG - Intronic
1025074151 7:55927919-55927941 AAGCCACAAGAGATGGAGCAAGG + Intronic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026295408 7:69047700-69047722 AAGAGAAAATAAATGGATCATGG - Intergenic
1026488767 7:70845415-70845437 AAGGGAAATCAGAAAGAGAAAGG + Intergenic
1027357407 7:77371413-77371435 AAAAGAAAAAAGATGGAGGACGG - Intronic
1027447424 7:78290270-78290292 AATGGAAAACAAAAAGAGCAGGG + Intronic
1028077178 7:86531450-86531472 AATGGAAAACAGAATAAGCAGGG - Intergenic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1029204655 7:98862337-98862359 AAGGGAAAACAGAGAGAGAAGGG + Intronic
1029280591 7:99433051-99433073 AAGGGAAAAGAAAGGGAACATGG + Intronic
1029353466 7:100032415-100032437 AAATGACAACAGAGGGAGCATGG - Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1030230007 7:107197883-107197905 CAGGAAAAACAAATTGAGCAAGG - Intronic
1030344278 7:108415171-108415193 AAGGGAAACCAGAAGGCTCAGGG - Intronic
1030998046 7:116382383-116382405 AAGGGACAGCACATGGACCAGGG + Intronic
1032259134 7:130320707-130320729 AAGGAAATACAGATGGAAAATGG - Intronic
1032350139 7:131154448-131154470 AAGGGAATATAGATGTAACATGG + Intronic
1033133342 7:138764223-138764245 AGGGGAAAGGAGATGGAGGAGGG + Intronic
1033455769 7:141502095-141502117 AGGGGATAACAGATGAAGCAAGG - Intergenic
1033648230 7:143321254-143321276 AGGGGCACACAGAAGGAGCACGG + Intronic
1033834909 7:145298518-145298540 AAGGGATAAAAAATAGAGCAGGG - Intergenic
1033897650 7:146094450-146094472 AAATGCAAGCAGATGGAGCAGGG + Intergenic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034212801 7:149379699-149379721 GAGGAAAAACAGATGCAGAAAGG - Intergenic
1034749844 7:153558517-153558539 AAGGTAAGAGAGAGGGAGCAAGG - Intergenic
1037923658 8:22828128-22828150 AAGGGAAAATGGAGGCAGCAGGG + Intronic
1038166527 8:25090248-25090270 AAGGGAAAAAAGATGGGGCTTGG + Intergenic
1038403947 8:27308032-27308054 AAGTGACAACAGATGCAGAACGG + Intronic
1038831892 8:31071218-31071240 AAAGGAAAGCAGATGGGCCATGG + Intronic
1039271649 8:35887839-35887861 AAGGGAAAAAGGAAGGACCATGG + Intergenic
1039306804 8:36272182-36272204 AAAAGAAAGCAGATGGAGGAGGG - Intergenic
1039707226 8:40020219-40020241 AATGGAAAACAAATAAAGCAAGG - Intergenic
1041562015 8:59228550-59228572 AATGGAAAACAGAAAAAGCAGGG + Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041955662 8:63555997-63556019 AAAGCAAAACAGATGATGCAGGG - Intergenic
1041986707 8:63930573-63930595 AAGGTCAAACTGATGGCGCAAGG + Intergenic
1041990288 8:63980239-63980261 AAGGGAAAAAAGATGGGGGATGG - Intergenic
1042078083 8:65018008-65018030 CAGGGAAAACAGAGGTAGCTAGG + Intergenic
1043074242 8:75675888-75675910 TATGGAAAAGAAATGGAGCAGGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043773630 8:84236597-84236619 AAAGGAAAAGAGATGCAGAAAGG + Intronic
1044327794 8:90879437-90879459 AAGTGAAAACAGGTTGGGCATGG - Intronic
1044451686 8:92342883-92342905 AAGTGAAAACAGACTGAGCCTGG - Intergenic
1045123858 8:99067932-99067954 ATGGGAAAACAATGGGAGCATGG - Intronic
1046013352 8:108576676-108576698 AAGAGAAAAAACATGGTGCAGGG + Intergenic
1046221829 8:111226788-111226810 AAGGGAAAAGAGAGGGAGTTTGG - Intergenic
1046719412 8:117602331-117602353 AAGGGAAAAAAGCTGTAGAATGG - Intergenic
1046893765 8:119450809-119450831 CAGGGAGAATACATGGAGCAAGG - Intergenic
1046921904 8:119739491-119739513 AAGGGAAAACTGGGGAAGCAAGG + Intronic
1046978506 8:120311035-120311057 AATTGGAAACAGATGAAGCAAGG + Intronic
1048265981 8:132987063-132987085 AAAAAAAAAAAGATGGAGCATGG + Intronic
1048437361 8:134431056-134431078 AAAGAAAAACATAAGGAGCATGG + Intergenic
1048769904 8:137884147-137884169 AAGGAAAAGGAGAAGGAGCAGGG - Intergenic
1049579266 8:143404022-143404044 AAGGAAAAACAAAGGGAACATGG + Intergenic
1050086025 9:1966617-1966639 AAGGGCTAACAGTTGGAGTAGGG - Intergenic
1050165017 9:2756401-2756423 AAGGGAAAAAAGAGGGGACAGGG + Intronic
1050247558 9:3706923-3706945 CAGGGAGAACAGGTTGAGCACGG + Intergenic
1050812147 9:9761854-9761876 AAGAGGAAAGAGGTGGAGCATGG - Intronic
1051349612 9:16186575-16186597 AAGAGAACACAGTTGGGGCAGGG + Intergenic
1051609215 9:18945132-18945154 AAGGGAAAACTGGAGGAGAATGG - Intronic
1052446886 9:28574537-28574559 AAGCCAAAACTGATGGTGCAGGG + Intronic
1052502984 9:29316826-29316848 CAGGGACAAGAGATGGAGCAGGG + Intergenic
1053089191 9:35258316-35258338 AAGGCAAAACAGAAAGAGAAAGG - Intronic
1054717791 9:68574285-68574307 ATGGGAAAACAAATGAACCAAGG + Intergenic
1055512854 9:77012368-77012390 AACCCAAAACAGAAGGAGCAGGG + Intergenic
1055633493 9:78249276-78249298 AAGGGAAAAAAAATGGAACTGGG - Intronic
1056376884 9:86023446-86023468 AGAGGAAAACAGAATGAGCATGG + Intergenic
1056907202 9:90663632-90663654 AATGGAAAACAGAGAAAGCAAGG - Intergenic
1057045454 9:91882789-91882811 ACGTGAAAACAGAGGGAGAAAGG + Intronic
1057093162 9:92278942-92278964 AAGGGTACACAGATGCATCAAGG - Intronic
1057464986 9:95304774-95304796 AAGGGAAAACAGAAGAAATAAGG + Intronic
1058769930 9:108220833-108220855 AAGGGAAAAGAGATTGAGATGGG - Intergenic
1059513789 9:114874436-114874458 ATGGGAAAACAGACACAGCAAGG + Intergenic
1059655533 9:116354226-116354248 AAGGAAGAGCAGAAGGAGCAAGG + Intronic
1059745465 9:117196146-117196168 AAGGTAACACAGCTGGAGTATGG - Intronic
1059814665 9:117899331-117899353 GGGGGAGAAGAGATGGAGCAAGG - Intergenic
1059990776 9:119863276-119863298 AAGGTATAACAAATGTAGCAAGG + Intergenic
1060119891 9:120979088-120979110 AAGGAAAAAGTGAGGGAGCAAGG - Intronic
1060777196 9:126383682-126383704 AAGAGAGAACAGATGGGGGAGGG + Intronic
1060873227 9:127059586-127059608 AAGGGATAGCAAATGGATCAGGG - Intronic
1061279459 9:129588900-129588922 AAGGGAAAAAAGGTGGATTAAGG + Intergenic
1061316564 9:129799911-129799933 AGGGGAAATGAGAAGGAGCATGG - Intergenic
1062209064 9:135353416-135353438 AAGGGAAGACAGACGGGGCCAGG + Intergenic
1203445593 Un_GL000219v1:52219-52241 CAGGGAATACAGATTGTGCATGG - Intergenic
1203636758 Un_KI270750v1:119953-119975 AATGGAGAGCAGATAGAGCAAGG + Intergenic
1186270490 X:7881511-7881533 ATGGGAAAACAGAGTGATCAAGG - Intergenic
1187167542 X:16818536-16818558 AGGAGAAAAAAGATGGAGAAGGG - Intronic
1187393983 X:18904215-18904237 AGTGGAAAACAGAAGGAGAAGGG + Intronic
1187422855 X:19151337-19151359 AAGGGAGAAGAGATAGAGGAAGG - Intergenic
1187472342 X:19580327-19580349 TATGGAAAAAAGATGGAGAATGG - Intronic
1188424313 X:30029051-30029073 AAAGTAAAAAAGATGGAGAATGG - Intergenic
1188922314 X:35992134-35992156 AAGGGAAAAGAGAAGAAACAGGG - Intergenic
1189042823 X:37560750-37560772 AAGGGGTAACAGATGGCACATGG + Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1192702958 X:73495859-73495881 AATGGAAAGCAGAAGAAGCAGGG - Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194900214 X:99500225-99500247 AATGGAAAACAGAAAAAGCAGGG + Intergenic
1195246777 X:103002193-103002215 AAGGAAATAAAGATGGGGCAGGG - Intergenic
1195286814 X:103393806-103393828 AAGGGAAAACTGAGGTAACAAGG + Intergenic
1195343417 X:103926302-103926324 GTGGGAAAATGGATGGAGCAGGG + Intronic
1195747577 X:108134357-108134379 AAGGGAAATCAATTGGAGAATGG + Exonic
1195828649 X:109031351-109031373 AAGAGAAAACAAATGAAGAACGG - Intergenic
1197030966 X:121815329-121815351 AAGGAAAAACACATAGAGAAGGG - Intergenic
1197144095 X:123151945-123151967 AAATGAAAACAAATAGAGCAAGG + Intergenic
1197263512 X:124341667-124341689 AAGGGAAAAAAGAGGGGGAAAGG + Intronic
1198108971 X:133485800-133485822 AAGGGGAAACTGAGGGGGCAGGG + Intergenic
1199321172 X:146440990-146441012 AAGAGAAAACAGGGGGAGGAAGG + Intergenic
1199547526 X:149021937-149021959 AAGGGAAAAGGGAGGGAGAAAGG - Intergenic
1200037410 X:153341070-153341092 AAAAGTAAACAGATGGAGAATGG - Intronic
1200838947 Y:7760849-7760871 AGGGGAAAATATAAGGAGCAAGG + Intergenic
1200944157 Y:8815732-8815754 GAAGGAAAACTGATGGAACAGGG - Intergenic
1201171809 Y:11273882-11273904 AAGGGGTAACAGATGGAACCTGG - Intergenic
1201453008 Y:14136324-14136346 AAGGGAAAAGAGAAGGAAAATGG - Intergenic
1201681471 Y:16649033-16649055 AATGGCAAACACATGGAACAGGG - Intergenic