ID: 1094673396

View in Genome Browser
Species Human (GRCh38)
Location 12:32593994-32594016
Sequence ATCTGGTGGTAGGAGCATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094673396 Original CRISPR ATCTGGTGGTAGGAGCATAG AGG Intronic
902595542 1:17507269-17507291 ATGTGGTGGAAGGTGCCTAGGGG - Intergenic
904382579 1:30121343-30121365 ATCTGAAGGTAGGAGCATTGTGG + Intergenic
909720187 1:78758768-78758790 ATCTGGTGCTATAAGTATAGTGG + Intergenic
911378683 1:97084960-97084982 ATATGGTAGTAGGCACATAGTGG + Intronic
912381543 1:109250375-109250397 AGCTGGTGGTAGGGGAATATGGG - Exonic
913134185 1:115872194-115872216 CTCAGGTGGTAGGAGCATCAAGG + Intergenic
913683140 1:121206197-121206219 GTCTGGGGGAAGGAGCATGGGGG - Intronic
916510226 1:165466733-165466755 CTCTGGTGGCAGTAGAATAGTGG + Intergenic
919234353 1:194819426-194819448 TTCTGGTTGGAGGAGCAAAGGGG + Intergenic
922006306 1:221534243-221534265 AGCTGGTGTCAGAAGCATAGTGG - Intergenic
923200801 1:231709447-231709469 CTCTGGAGGTAGAAGCACAGTGG + Intronic
923533031 1:234826682-234826704 ATCTGTTGAGAGGAGCTTAGAGG + Intergenic
923721770 1:236473200-236473222 ATATGGTGGTAGGTGCCTTGAGG + Intronic
924437114 1:244051139-244051161 AGCTGGTGGCAGGAGTGTAGAGG + Intronic
1067260179 10:44682725-44682747 TTCCGGTGGTAGGACCAGAGAGG + Intergenic
1068066128 10:52134331-52134353 GTCTGGAGATAGGAGAATAGAGG - Intronic
1069178144 10:65320856-65320878 ATCTGGTGGGAGGAGTGAAGGGG - Intergenic
1069551847 10:69369486-69369508 ATCTGGTGGAAGGAGACGAGGGG + Exonic
1072840439 10:98768349-98768371 AGGTGGTGGTAGGAGGAAAGCGG + Intronic
1074521743 10:114231677-114231699 ATTTGGTGGAAGGAACTTAGAGG - Exonic
1078872191 11:15357959-15357981 GTCTGTTGGTAGCAGCAGAGGGG + Intergenic
1079974625 11:27076222-27076244 ATCTGCTGCTAGGAGACTAGAGG - Intronic
1080067701 11:28038904-28038926 AATTGGTGGTAGCAGCACAGTGG - Intronic
1080550823 11:33372844-33372866 ATCTGGTGAGAGAAGCACAGAGG - Intergenic
1081367746 11:42257194-42257216 ATGTGGTGATTGGATCATAGAGG - Intergenic
1082171133 11:49007208-49007230 ATCTGGGGGTTGGGGGATAGGGG - Intergenic
1083491408 11:63017299-63017321 TTCTGGAGGTAGGAACAGAGAGG - Intergenic
1084428681 11:69099643-69099665 AACAGGTGGTAGGAGCTGAGAGG - Intergenic
1085201293 11:74703783-74703805 ATCTTGTGGTAGGAGAACTGAGG + Intronic
1086566191 11:88230103-88230125 CTCTGGTGGTAGTAGCAGTGGGG + Intergenic
1086694769 11:89829881-89829903 ATCTGGGGGTTGGGGGATAGGGG + Intergenic
1086711379 11:90014616-90014638 ATCTGGGGGTTGGGGGATAGGGG - Intergenic
1086931430 11:92697438-92697460 TTCTGGAGGTAAGCGCATAGAGG + Exonic
1087630747 11:100647757-100647779 ATCTGGTGGTAGGGACAAATAGG + Intergenic
1088743830 11:112787974-112787996 ACATGGTGGAAGGAGCAGAGAGG - Intergenic
1090959560 11:131544024-131544046 ATATGGTGGTAGGGGCCTTGAGG - Intronic
1092265308 12:6976409-6976431 CTCTTGTGGGAGGAGCAGAGGGG - Exonic
1092279763 12:7090247-7090269 ATCTGGTGGAAGAAGGACAGGGG + Exonic
1092893088 12:12987510-12987532 CGCTGTTGGTAGGAGTATAGTGG + Intronic
1094673396 12:32593994-32594016 ATCTGGTGGTAGGAGCATAGAGG + Intronic
1099237207 12:80095736-80095758 ATGTGGTTGTAGGTGCAAAGGGG + Intergenic
1104070720 12:125343068-125343090 AGCTGGAGGTAGGAGCAAACTGG + Intronic
1106085810 13:26540584-26540606 AGCTGGTGGCAGGAGCCAAGAGG - Intergenic
1108374385 13:49800514-49800536 ATCTGGTGGGTTGAGCACAGTGG - Intergenic
1112206719 13:97331387-97331409 ATCCGTTGGTAGGAGGATGGAGG - Intronic
1113452388 13:110420401-110420423 GTCTGGTGGTGGGAGCAGGGCGG + Intronic
1118320237 14:64748606-64748628 ATCTGGGGGGAGAAGCAGAGAGG + Exonic
1120682766 14:87500391-87500413 TTCTGCTGGTGGGAGAATAGAGG - Intergenic
1121910305 14:97784364-97784386 ATCTGATGGGATGAGCATGGTGG - Intergenic
1126035542 15:44541839-44541861 ATCTGGTTGGAGGAGGAAAGTGG - Intronic
1128745889 15:70113845-70113867 ACCTGCTGGTAGCAGCAGAGTGG - Intergenic
1133218285 16:4306766-4306788 TTCTGGTGGCAGGAGGAGAGAGG - Intergenic
1133704348 16:8339174-8339196 AGGTGGTAGTAGGAACATAGCGG + Intergenic
1141633226 16:85300445-85300467 ATCTGCTGGGAGGAGAACAGGGG - Intergenic
1149006167 17:51807908-51807930 ATCTGGTGGAGGTAACATAGGGG + Intronic
1151066964 17:71161606-71161628 ATCTCATGCTATGAGCATAGAGG + Intergenic
1151519448 17:74617704-74617726 AGCTGGAGGCAGGAGCAGAGAGG + Intronic
1163078391 19:14917212-14917234 ATTTTATGGTAGGAGCCTAGGGG + Intergenic
1164753462 19:30672602-30672624 ATCTGTTAGTAAGAGCATGGGGG + Intronic
1165910366 19:39222315-39222337 AGCTGCTGGTGGGAGCACAGGGG + Intergenic
1167118544 19:47502562-47502584 ACCTGGTGGTGGGACCATGGAGG - Intronic
1168148967 19:54434921-54434943 ATCTGGTGGGTGGAGCTGAGTGG + Intronic
1168429386 19:56265865-56265887 ATCTGGTGCAAGGAGCTTTGAGG + Intronic
929479594 2:42291941-42291963 ATATTTTGGTAGGTGCATAGTGG - Intronic
932819368 2:74886535-74886557 AACTGGTGGAAGGAGAAGAGGGG + Exonic
932935546 2:76097712-76097734 ACCTGGTGGGAGGAACATGGGGG - Intergenic
935654747 2:105412521-105412543 AGCTGATGGTATGAACATAGGGG + Intronic
936719327 2:115231790-115231812 ATACTGTGGTGGGAGCATAGAGG - Intronic
944208183 2:197179330-197179352 ATTTGGTGGTAGGAGTTGAGTGG - Intronic
947706340 2:232279306-232279328 GTGTGGTGATAGGTGCATAGTGG + Intronic
947730809 2:232430284-232430306 ATCTTGTGGTACTAACATAGGGG - Intergenic
948482415 2:238258521-238258543 ATCTGCTGGTAGGAGCAGGTGGG + Exonic
1171148845 20:22809451-22809473 ATGTGATGGCAGGAGCCTAGGGG - Intergenic
1171750341 20:29043155-29043177 ATCTGGTGTTCGGAGCCCAGAGG + Intergenic
1174627562 20:51927985-51928007 ATCTGGGGCTCGGAGCATAGTGG + Intergenic
1176697421 21:9997023-9997045 GTCTGGTGGTAGGAAAATACTGG - Intergenic
1177126559 21:17200978-17201000 ATCTGGTGGTGGGGGCATTTTGG - Intergenic
1177659497 21:24064424-24064446 AACCAGTGGTAGGAGCATAGGGG + Intergenic
1178059342 21:28834792-28834814 ATCTGGTGGTGGGGGCATGGTGG + Intergenic
1182676387 22:32042884-32042906 ACCTGGGGCTAGGAGCCTAGAGG - Intergenic
1183313685 22:37125488-37125510 ATCTGGAGGGAGGGGGATAGAGG + Intergenic
1184092070 22:42298142-42298164 ATCTGGTGATAGGAGCACCAGGG - Intronic
956915834 3:73869782-73869804 ATCTGGTGGTAGGAGAACCATGG - Intergenic
958518930 3:95158869-95158891 GTCAGGGGGTAGGAGGATAGGGG - Intergenic
961554934 3:127691029-127691051 CTCTGGTGGCAGGAGAAGAGAGG - Exonic
963991680 3:151663746-151663768 ATATGGTGGTAGATGCAGAGGGG - Intergenic
964055213 3:152447177-152447199 ATCTGGGGGGAGGAGCAGAGTGG + Intronic
966371248 3:179252667-179252689 CTCTGGTGGTAGGATGATAGGGG - Intronic
969957732 4:10909177-10909199 ACGTGGTGGAAGGAGCAGAGTGG - Intergenic
970052011 4:11924946-11924968 GTCTGGGGGTGGGAGAATAGGGG + Intergenic
970563692 4:17309776-17309798 ATGTGGTGGTAGGTGCTGAGTGG + Intergenic
975247462 4:72136290-72136312 CAGTGGTGGTAGGAGCAGAGGGG + Intronic
975452200 4:74541766-74541788 ATGTGGTGGTGGCAGCAGAGAGG + Intergenic
976217784 4:82731150-82731172 AGCTGGGGGTAGGGGCAGAGAGG + Intronic
979925561 4:126558794-126558816 ATATGGTGGAAGGGGCAAAGAGG - Intergenic
980370023 4:131857205-131857227 GTCTGGTGGTAGGAAAATACTGG - Intergenic
981861970 4:149366395-149366417 TTTTGGAGGTAGGATCATAGAGG - Intergenic
984251406 4:177339949-177339971 ATCTAGTGGAAAGAGCATGGAGG + Intronic
985432257 4:189892789-189892811 ATCTGGTGTTTGGAGCCCAGAGG + Intergenic
987162677 5:15160548-15160570 ATCTGGTGGTGGGAGGAAAAAGG + Intergenic
990467065 5:56080337-56080359 ATCTGGTGGTTGGGGCATTTTGG + Intergenic
992777700 5:80102842-80102864 ATCTGGTGCAAGGAGCCCAGGGG + Intergenic
994722813 5:103400414-103400436 AACTGGTGGGAGTAGCTTAGAGG + Intergenic
1000465238 5:161567676-161567698 TTCTAGTGGAAGGAGGATAGGGG + Intronic
1002423835 5:179164439-179164461 ACCTGGTGGCAGGAGCTGAGAGG + Intronic
1003290318 6:4775082-4775104 AACTGGTGGGAGGAGCCTTGTGG + Intronic
1004369124 6:15037043-15037065 AGGTGGTGGTAGGAGCAAACAGG - Intergenic
1006234790 6:32619658-32619680 CTCTGGAGGCTGGAGCATAGTGG - Intergenic
1006594682 6:35184445-35184467 ATCTAGTGGGTGGAGAATAGGGG - Intergenic
1007237055 6:40398192-40398214 ATCTGGTGGGTGGAGCCCAGGGG - Intronic
1007518576 6:42433166-42433188 ATCTGGTGCAAGGAACACAGAGG + Intronic
1010351762 6:74883254-74883276 ATTCTGTGGTAGGAGCATACTGG - Intergenic
1015509398 6:134023059-134023081 ATCTGGGGGTTGGGGCAAAGGGG - Intronic
1017343569 6:153354477-153354499 AACTAGTGGTAGGAGGATTGTGG + Intergenic
1017498611 6:155003621-155003643 CTCTTGTGGGAGGAGCAGAGGGG + Intronic
1018944387 6:168336109-168336131 ATCTTGTGTTAGTAGCAGAGTGG - Intergenic
1021974855 7:26001993-26002015 ACCAGGTGGTAGGGGCACAGAGG - Intergenic
1022618174 7:31953970-31953992 ATGTGGTGAAAGGAGCAGAGTGG - Intronic
1022893434 7:34724619-34724641 ATCTGGTGGTCTGCACATAGTGG + Intronic
1026819522 7:73537473-73537495 ATCTGCTGGAAGGAGCAGAGTGG - Intronic
1028747815 7:94347573-94347595 ATCTGGTCGTTGGGGCAGAGTGG - Intergenic
1028909636 7:96193748-96193770 ATCTAGTGGGAAGAGAATAGGGG - Intronic
1029194349 7:98794419-98794441 GTAGGGTGGTAGGAGGATAGAGG - Intergenic
1029250517 7:99232938-99232960 AACTGGTGGGAGGAGAGTAGAGG + Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1037779093 8:21855581-21855603 ACCTGGAGGCAGGTGCATAGAGG - Intergenic
1038306999 8:26413876-26413898 ATGGGGTGGTAGGAGCAAAGAGG + Intronic
1039722100 8:40175158-40175180 ATCTGATTGTAGGATCAAAGTGG + Intergenic
1041078036 8:54187000-54187022 ATCTGCTGGAAGTAGCAAAGGGG + Intergenic
1047767866 8:128003999-128004021 ACATGGTTGTAGGAGCAGAGAGG + Intergenic
1047950824 8:129933248-129933270 GTTTGGGGGTAGGAGCAGAGAGG - Intronic
1048176656 8:132158572-132158594 AGCTGGAAGGAGGAGCATAGTGG + Intronic
1048415490 8:134223744-134223766 ATCTGGTGGTAAGGGCAGTGAGG + Intergenic
1052516992 9:29494613-29494635 ATTGGGTGGTAGGGGCAAAGGGG + Intergenic
1052877709 9:33579806-33579828 ATCTGGTGGAATGAGCATCTAGG + Intergenic
1053498275 9:38564399-38564421 ATCTGGTGGAATGAGCATCTAGG - Intronic
1053634413 9:39982854-39982876 GTCTGGTGGTAGGAAAATACTGG - Intergenic
1053771337 9:41480631-41480653 GTCTGGTGGTAGGAAAATACTGG + Intergenic
1054209474 9:62267843-62267865 GTCTGGTGGTAGGAAAATACTGG + Intergenic
1054315519 9:63581135-63581157 GTCTGGTGGTAGGAAAATACTGG - Intergenic
1054377572 9:64461062-64461084 GTAGGGTGGTAGGAGGATAGGGG + Intergenic
1060603459 9:124893859-124893881 ATCTGCTTGTAGGAGCCTACAGG - Intronic
1060733191 9:126050626-126050648 ATCTGGTGGTGGGAGCTGAGGGG - Intergenic
1185540915 X:902543-902565 TTCTGGTGGGTGGACCATAGTGG + Intergenic
1185540979 X:902830-902852 TTCTGGTGGGTGGACCATAGTGG + Intergenic
1185540990 X:902882-902904 TTCTGGTGGGTGGACCATAGTGG + Intergenic
1185694535 X:2185513-2185535 ATCTGGTGGGTGGAGCCCAGGGG + Intergenic
1185992938 X:4912346-4912368 ATGTGGTGGCAGGAGCCTGGTGG + Intergenic
1186689513 X:11960208-11960230 ATCTGGAGGGAGGAGCAGGGAGG - Intergenic
1189140159 X:38596102-38596124 ATCTGGGGGTAAGAGCATAGAGG + Intronic
1193360250 X:80572504-80572526 AACTGGTGGAAGGAGAAGAGGGG - Intergenic
1200070417 X:153526305-153526327 AGCTGGTGGTGGGAGGGTAGGGG + Intronic
1201688270 Y:16732138-16732160 GTCTGGAGGTAGGGGGATAGGGG - Intergenic