ID: 1094676410

View in Genome Browser
Species Human (GRCh38)
Location 12:32624978-32625000
Sequence AAGCATCGATGGTTTCTTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094676410_1094676414 19 Left 1094676410 12:32624978-32625000 CCTTCAAGAAACCATCGATGCTT 0: 1
1: 0
2: 1
3: 6
4: 80
Right 1094676414 12:32625020-32625042 CTTCAGAAATGCAATTGCAAAGG 0: 1
1: 0
2: 1
3: 38
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094676410 Original CRISPR AAGCATCGATGGTTTCTTGA AGG (reversed) Exonic
903239486 1:21973530-21973552 CAGCATGGATGGTGTCCTGATGG - Intergenic
903614376 1:24641595-24641617 CAGCAGGGAGGGTTTCTTGATGG + Intronic
904051409 1:27641567-27641589 AATCATCAATGGTTGATTGATGG + Intergenic
912539635 1:110404381-110404403 GAGCCTTGAAGGTTTCTTGAAGG + Intronic
918899505 1:190395804-190395826 GAGCATCGATGGACTCTTCAAGG - Intronic
919038659 1:192351175-192351197 AAGCATCAATGTTTTCCTTAAGG + Intronic
923971628 1:239208972-239208994 TAGCATATAGGGTTTCTTGATGG + Intergenic
1071160266 10:82737591-82737613 AAGCATCCATTGTTGCTTAAAGG - Intronic
1085063804 11:73473600-73473622 AAGCATGCATGGTGTCTTCAGGG - Intronic
1086165905 11:83777632-83777654 AAGCATTTATTGTTTCTTGGGGG - Intronic
1086915495 11:92525394-92525416 AAACATGGATGCTTCCTTGATGG - Intronic
1092249525 12:6885180-6885202 AAGAATTGATGTTTTCTTGTGGG + Intronic
1094676410 12:32624978-32625000 AAGCATCGATGGTTTCTTGAAGG - Exonic
1098469179 12:70824438-70824460 TAGCTACCATGGTTTCTTGATGG - Intronic
1101974632 12:109346312-109346334 GAGCATCCATGGATTTTTGAAGG + Intergenic
1115744138 14:36418734-36418756 AATCAAGGAAGGTTTCTTGAAGG + Intergenic
1122503572 14:102217676-102217698 AAGCAGCCATGGTTTATTCACGG - Intronic
1123775709 15:23577951-23577973 AAGTATTTATGGTTTCCTGAAGG - Intronic
1126962158 15:54009083-54009105 AAGCATCTATGGTTTTATGATGG + Intergenic
1129036091 15:72649043-72649065 AAGCCTCAATGGTGTCTCGATGG + Intergenic
1129391622 15:75223755-75223777 AAGCCTCAATGGTGTCCTGATGG + Intergenic
1129472680 15:75764099-75764121 AAGCCTCAATGGTGTCCTGATGG - Intergenic
1129730937 15:77932518-77932540 AAGCCTCAATGGTGTCTTAATGG - Intergenic
1139254183 16:65525256-65525278 AAGCCTGGCTGGTTTCTTGATGG - Intergenic
1140279897 16:73544655-73544677 AAGCATCTTTGGTCTCTTTATGG - Intergenic
1140596352 16:76419434-76419456 ATGCATGGATGGGTTCTTGGAGG + Intronic
1141346016 16:83246761-83246783 AAGCATCAATGGTTTCAGCAAGG - Intronic
1148258453 17:46157399-46157421 AAGCTTCCATGGTTTACTGATGG - Intronic
1151872596 17:76846472-76846494 AGGCTTGGATTGTTTCTTGAGGG + Intergenic
1160622950 18:80183399-80183421 AGGCAGAGATGGTTTCCTGAGGG + Intronic
1162148585 19:8629200-8629222 AAGCATGGAAGGCTTCTTGGAGG + Intergenic
1164794712 19:31016262-31016284 AAGTATCGATGTTTTCCTCAAGG - Intergenic
1168563622 19:57404318-57404340 AAGCATGAATGGTTTTTTGTGGG + Intronic
1168699789 19:58430705-58430727 AAGAATCGATTTCTTCTTGAGGG + Intergenic
926482361 2:13415029-13415051 AAGCATTGATGGTGTCCTGGGGG + Intergenic
929718933 2:44346333-44346355 ATGCATCCATGTTTTCTGGAAGG + Exonic
929952697 2:46428656-46428678 TAGCATCCAGGGGTTCTTGAGGG - Intergenic
931978496 2:67669106-67669128 AAGCATCCATGGCTTGTGGAAGG - Intergenic
933381305 2:81549770-81549792 CAGCATCGATGTTTTCCTGATGG + Intergenic
935244758 2:101208336-101208358 AAGCATGCATGGCTTCTTGGAGG + Intronic
938956987 2:136307995-136308017 AGGCAGCAATGGTGTCTTGAAGG - Intergenic
944041906 2:195365386-195365408 GAGCATCATTGGTTCCTTGATGG - Intergenic
947563335 2:231177191-231177213 AATCATGGAGGGCTTCTTGAAGG - Intergenic
1174562153 20:51439106-51439128 AAGCTTCCACGGTATCTTGAGGG - Intronic
1177884264 21:26730251-26730273 AAGAATCACTGGTTTCCTGAAGG - Intergenic
951797231 3:26553088-26553110 AAGCATTGAAGGTTTCTGAAGGG + Intergenic
952990532 3:38827457-38827479 AAGCCTGCATGGTTTCTTGAAGG + Intergenic
956169883 3:66424479-66424501 AAACATGGATAGTTTCCTGAAGG - Intronic
958757033 3:98261420-98261442 AATCATTGATGGATTTTTGAAGG - Intergenic
961111180 3:124284473-124284495 AAGCATGGATGGCTTCTGGGTGG - Intronic
965763256 3:172103530-172103552 AAGCATCTATGGATTCTTGAAGG + Intronic
967566389 3:190978706-190978728 AAGATTCGATGGTTTTATGAGGG + Intergenic
971007126 4:22387944-22387966 AAGCATCGCTGCTGTCTTGCTGG + Exonic
972368241 4:38395821-38395843 AGGAACAGATGGTTTCTTGAAGG - Intergenic
976225250 4:82790611-82790633 GAGAATGGATGGTGTCTTGAGGG + Intronic
977959102 4:103064648-103064670 AAGCATTTATCGTTTCTTCATGG - Intronic
980059003 4:128108513-128108535 CATCATCGATGCTTTGTTGATGG - Intronic
991685701 5:69180433-69180455 AAGGATTGATAGTTTCTAGATGG - Intergenic
993335935 5:86658977-86658999 ATGCATAGATGATTTCTAGAAGG - Intergenic
995265108 5:110151085-110151107 AACCCTTGATGGGTTCTTGATGG + Intergenic
998869919 5:146541925-146541947 CTGCATCCAGGGTTTCTTGAAGG - Intergenic
1000901697 5:166919062-166919084 AACCATCCATGAATTCTTGAGGG - Intergenic
1006963269 6:37955848-37955870 AAGAATCCATGGGTTCTTGATGG + Intronic
1011751648 6:90460524-90460546 AAGCAAGCATGGTTTCTGGATGG - Intergenic
1012866227 6:104621625-104621647 AAGCCTAGATTGTTTTTTGAAGG - Intergenic
1015993548 6:138974254-138974276 AAGAATTGATAGATTCTTGAAGG - Intronic
1017751538 6:157493676-157493698 AAGCAGCGATGCTGTCCTGAGGG + Intronic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1024360417 7:48462188-48462210 AAGCCTTGATGGTTTCTGGCAGG + Intronic
1026393669 7:69928721-69928743 AAGCATCCATGTGTTCTTGGGGG - Intronic
1027753174 7:82177706-82177728 AAAGATTGATGGTCTCTTGATGG - Intronic
1030354678 7:108528906-108528928 AAGTATAGATGATTTCCTGAAGG - Intronic
1032884213 7:136120734-136120756 AAGATTCGATGGTTTTATGAAGG - Intergenic
1036044115 8:5120441-5120463 CAGCCCCGATGCTTTCTTGATGG + Intergenic
1038522700 8:28247092-28247114 AAGCATCCATGGTTTCATTCTGG - Intergenic
1040805836 8:51395330-51395352 CTGCATCGATGATTTCTGGAGGG - Intronic
1042412315 8:68479639-68479661 CAGCATCCATGGCTTTTTGAGGG + Intronic
1047195147 8:122714242-122714264 ATCCATCAATGGTGTCTTGATGG - Intergenic
1047405501 8:124582262-124582284 AACCATTGAAAGTTTCTTGAAGG + Intronic
1048014957 8:130489172-130489194 CAGCCTACATGGTTTCTTGAGGG - Intergenic
1048486379 8:134851571-134851593 CAGCATCAATGGCTTCTTGATGG - Intergenic
1055153006 9:73025630-73025652 AAACATCGATGTTTTGTTCAGGG + Intronic
1055284550 9:74714555-74714577 AAGCTTAGATCATTTCTTGAAGG - Intergenic
1059054890 9:110969017-110969039 AAGAAACACTGGTTTCTTGAGGG - Intronic
1060723863 9:125995008-125995030 AAACAGGGATGGTTTCCTGAGGG - Intergenic
1189369345 X:40415591-40415613 AATCAACGAAGGCTTCTTGAAGG + Intergenic
1189711237 X:43814450-43814472 AAGCTTGGAAGGCTTCTTGAAGG - Intronic
1190621080 X:52287689-52287711 AAGCATTGATGGCATGTTGATGG + Intergenic