ID: 1094677900

View in Genome Browser
Species Human (GRCh38)
Location 12:32639054-32639076
Sequence AGGAATGAGCATGAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 721
Summary {0: 1, 1: 0, 2: 8, 3: 75, 4: 637}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094677895_1094677900 23 Left 1094677895 12:32639008-32639030 CCTTTCTTGTCTCATTCAATGGG 0: 1
1: 0
2: 2
3: 12
4: 183
Right 1094677900 12:32639054-32639076 AGGAATGAGCATGAGGAGAAGGG 0: 1
1: 0
2: 8
3: 75
4: 637
1094677892_1094677900 25 Left 1094677892 12:32639006-32639028 CCCCTTTCTTGTCTCATTCAATG 0: 1
1: 0
2: 1
3: 23
4: 343
Right 1094677900 12:32639054-32639076 AGGAATGAGCATGAGGAGAAGGG 0: 1
1: 0
2: 8
3: 75
4: 637
1094677893_1094677900 24 Left 1094677893 12:32639007-32639029 CCCTTTCTTGTCTCATTCAATGG 0: 1
1: 0
2: 1
3: 23
4: 303
Right 1094677900 12:32639054-32639076 AGGAATGAGCATGAGGAGAAGGG 0: 1
1: 0
2: 8
3: 75
4: 637

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094677900 Original CRISPR AGGAATGAGCATGAGGAGAA GGG Intronic
900016114 1:151299-151321 AGAAATGAGCATGGTGGGAATGG - Intergenic
900046379 1:509897-509919 AGAAATGAGCATGGTGGGAATGG - Intergenic
900068580 1:751609-751631 AGAAATGAGCATGGTGGGAATGG - Intergenic
900868263 1:5283886-5283908 AAGAGTGAGAATGAGCAGAAAGG + Intergenic
901952907 1:12762715-12762737 AGGGAGGAGCATGAGGTAAATGG + Exonic
902108511 1:14058233-14058255 AGGAAGGAGGAAGAAGAGAAGGG - Intergenic
903318909 1:22529937-22529959 AGGAAGGAGAATGGTGAGAAGGG + Exonic
903364700 1:22798833-22798855 AGGCAGGAGCAGGATGAGAAGGG + Intronic
903581914 1:24377399-24377421 TAGGATGAGCAAGAGGAGAAGGG - Intronic
904231025 1:29072665-29072687 AAGAATGATTAAGAGGAGAATGG + Intronic
904359327 1:29961764-29961786 AGGGGAGAGCATGAGGAGAGGGG - Intergenic
904602961 1:31683815-31683837 AGGAAGAAGCTGGAGGAGAAGGG - Intronic
904615371 1:31746628-31746650 AGAGATGAGCTTGAGGAGAGAGG - Intronic
905081327 1:35323646-35323668 AGGCAGGAGAATGAGGAGAATGG - Intronic
905451015 1:38056185-38056207 AGGAATGTGTATGGGGAGAAAGG + Intergenic
905734855 1:40317676-40317698 AGGAAGGAGCCAGAGGAGAGGGG - Intronic
905794036 1:40805431-40805453 TGGAATGAGCAAGGGGAGAGTGG - Intronic
906032748 1:42734114-42734136 AGGTCTGAGCATGAGGGGCAGGG + Exonic
906077133 1:43060272-43060294 AGGAATGAGCATGAGAATCTGGG - Intergenic
906220471 1:44074334-44074356 GGCAATGAGGATGAGGAGAGGGG - Intergenic
906548639 1:46641755-46641777 AGGAATGGCCATGAGGTAAAAGG - Intronic
906757097 1:48328597-48328619 AGAAATGAGGAGGGGGAGAATGG + Intronic
906949632 1:50323718-50323740 TGGAATGAGCATGGGAAGACAGG - Intergenic
906968256 1:50481888-50481910 TGGAATGAGCAAGGGGAGAGGGG + Intronic
907573765 1:55507397-55507419 AGGAATGAAGAGCAGGAGAAGGG - Intergenic
907770604 1:57459787-57459809 AAGAATGAGAAAGAGGAGAGAGG - Intronic
907908665 1:58808379-58808401 AGCAATGAGCAGGAAGAGTAGGG - Intergenic
907921591 1:58919202-58919224 AGGAGTGAGCAGAAGGAGAATGG + Intergenic
907943334 1:59109757-59109779 AGCAAAGAGAAGGAGGAGAAGGG + Intergenic
909160248 1:72138117-72138139 AGGAATAAGGAGGAGTAGAAAGG + Intronic
909223966 1:72993082-72993104 AGGAAAGAGCAGGAGGACAGGGG + Intergenic
909349811 1:74638027-74638049 AGGAAGGAGGATGAGAAGGATGG + Intronic
909546865 1:76857993-76858015 AGTAATGAGAAAAAGGAGAAAGG + Intergenic
909674766 1:78226795-78226817 AGGAATGAGAATGCAGAGATGGG - Intergenic
909686563 1:78355277-78355299 AGAAAAAAGAATGAGGAGAAGGG - Intronic
910730996 1:90395936-90395958 ACTAATGAGCATGAAAAGAAGGG - Intergenic
911023761 1:93414920-93414942 AAGAAGGAGGAGGAGGAGAAAGG + Intergenic
911510877 1:98806344-98806366 AGCAAAGAGCAGGAGGAGAGGGG + Intergenic
912185237 1:107267487-107267509 AGGAATGAGCATGAGGGTACGGG - Intronic
912917570 1:113831596-113831618 AGAAATGAGCATGATGTGTATGG - Intronic
913069298 1:115284941-115284963 AGGACAGAGCAGGAGGAGGAGGG - Intergenic
913098713 1:115543447-115543469 AGGAGTAAGGATGAGGAGAAAGG + Intergenic
913191406 1:116416273-116416295 AGGACTGACCTTGAGGAGACAGG - Intergenic
914960093 1:152197426-152197448 AAGAAGGAGAAGGAGGAGAAGGG - Intergenic
915687580 1:157650152-157650174 TGGAATGAGAATGAGGGGAAAGG - Intergenic
916002086 1:160626813-160626835 AGGAATGAGCATGTGTTGGATGG - Intronic
916302133 1:163287370-163287392 ATGAAGGAGCATGAGTAGTAGGG - Intronic
917650136 1:177068218-177068240 AGGAATGAGAATGAGATGAGAGG - Intronic
917670626 1:177270303-177270325 GGAAATGAGCATGAGGATCATGG + Intronic
918063502 1:181083110-181083132 AGGAATGAAAATGGAGAGAAGGG + Intergenic
918233865 1:182559824-182559846 AGGAGAGAGTAAGAGGAGAAAGG - Intronic
918516490 1:185369357-185369379 AGGCCAGAGCCTGAGGAGAAAGG + Intergenic
919153121 1:193725048-193725070 ACAAAAGAGCAAGAGGAGAATGG - Intergenic
919257454 1:195142377-195142399 AAGAAGGAGGAGGAGGAGAAAGG - Intergenic
920035409 1:203061915-203061937 AAGAATGAGACTGAGGAGAAGGG - Intronic
920096748 1:203491534-203491556 AGGAAACAGCATGAGTACAAAGG + Intergenic
920346882 1:205311837-205311859 AGGCATGAGAGTGAGGAGAAAGG + Intronic
920550447 1:206856228-206856250 AGGAAGGAGCAAGAGGAAGACGG - Intergenic
920663717 1:207942869-207942891 AGGAAAGAGCAGGAAGACAATGG + Intergenic
920901764 1:210115777-210115799 AGCAAAGAGCAGGAGGACAAGGG + Intronic
921780056 1:219152214-219152236 ATGAATGAGCAAGAGGAGAGCGG + Intergenic
922103936 1:222496981-222497003 AGAAATGAGCATGGTGGGAATGG - Intergenic
922264257 1:223969512-223969534 AGAAATGAGCATGGTGGGAATGG - Intergenic
922722740 1:227906839-227906861 AGGAAGGAGGATGAGGAAGAGGG - Intergenic
923051721 1:230394873-230394895 GGGGAGGAGCATGAGGAGAGGGG - Intronic
923475302 1:234326086-234326108 AGGAAGGAGCAGGAGGAGGATGG + Intergenic
924176983 1:241401060-241401082 AGAAATGAACATGGGGAGGAAGG + Intergenic
924346105 1:243074505-243074527 AGAAATGAGCATGGTGGGAATGG - Intergenic
924497188 1:244601957-244601979 AGGAGAGAGAAGGAGGAGAAGGG + Intronic
924718206 1:246598448-246598470 AGGAATGTACATTAGGGGAATGG - Intronic
1062973101 10:1663423-1663445 AGGGATGAGCAGGCGGAGCACGG - Intronic
1065205228 10:23350995-23351017 AAGAAGGAGGAGGAGGAGAAGGG - Intergenic
1065623825 10:27610665-27610687 AGGAAGGAGGAGGAGGAGAAGGG - Intergenic
1066542706 10:36465903-36465925 AGGAATGAGTATCAGGAAAAAGG - Intergenic
1066770582 10:38842149-38842171 TGGAATGAAAATGAAGAGAATGG + Intergenic
1067295495 10:44973168-44973190 AGAAGTGAGCATGAGGAGGTGGG - Intronic
1067803677 10:49377925-49377947 AGCTATGATCATGAGGAGATGGG - Intronic
1068292974 10:55029784-55029806 GGGAATGTGGTTGAGGAGAAAGG + Intronic
1069888029 10:71636165-71636187 AGGAGAGAGAATCAGGAGAATGG + Intronic
1070569280 10:77628882-77628904 AGGATGGAGCAAGAGGAGGAGGG + Intronic
1070571854 10:77646005-77646027 CGGAATGCGAATGAGGAGCAGGG - Intergenic
1070606126 10:77899626-77899648 TGGAATGAGTATGAGGAGAGGGG - Intronic
1071906255 10:90177337-90177359 AAGAATGAGAATGAAGAGATAGG - Intergenic
1072643340 10:97231460-97231482 AGCTAAGAGTATGAGGAGAATGG - Intronic
1072647641 10:97270183-97270205 AAGAATGAACATGGGAAGAAAGG - Intronic
1072768180 10:98113366-98113388 AGGAGTTGGCATGAGCAGAAAGG + Intergenic
1073912826 10:108366851-108366873 TGTAATGAGGATGTGGAGAAGGG - Intergenic
1076677761 10:132156285-132156307 AGCAATCAGCATGAGCAGGATGG - Intronic
1076972705 11:146370-146392 AGAAATGAGCATGGTGGGAATGG - Intergenic
1077246363 11:1541218-1541240 AGGAAGGAGCCTGATTAGAAAGG - Intergenic
1077803328 11:5563953-5563975 AGGAATTAGCATAGGGACAATGG - Intronic
1079141424 11:17812592-17812614 AGGATTGAACAGGAGGAGAATGG - Intronic
1079243006 11:18733803-18733825 AGGACTCAGGATGAGGAGGAGGG + Intronic
1079445572 11:20553706-20553728 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1079822532 11:25148443-25148465 AGGGAAGGGCATGACGAGAAGGG + Intergenic
1080477790 11:32612349-32612371 AAGTATGATCATGAGGAAAATGG - Intronic
1080680752 11:34473590-34473612 AAAAATGAGGAGGAGGAGAAAGG - Intergenic
1082263451 11:50095769-50095791 AGAAATGAGCATGATGGGAATGG - Intergenic
1083076326 11:60042740-60042762 TGGAAAGAGAAAGAGGAGAAAGG - Intronic
1083098801 11:60281640-60281662 AGGAGAGAGCATGAGGAGAGTGG - Intronic
1083327211 11:61878838-61878860 AGGACTGAGCCTGGGGAGAGAGG + Exonic
1083751442 11:64763066-64763088 AGAAATGAACGTGAGGAGAGGGG + Intergenic
1084370217 11:68736816-68736838 AGGAAGGAGGAGGAGGAGAATGG + Intronic
1084826816 11:71737973-71737995 AGCAAAGAGCAGGAGGACAAGGG - Intergenic
1084930143 11:72548829-72548851 GGGCATGAGCATGAGGAGTTGGG - Intergenic
1085750350 11:79155765-79155787 GGGAATGAGGAAGAAGAGAAAGG - Intronic
1086136572 11:83448115-83448137 AGCAAAGAGCAGGAGGACAAGGG + Intergenic
1086550831 11:88049683-88049705 AGCAAAGAGCAGGAGGAGAGGGG - Intergenic
1088070140 11:105773108-105773130 AAGAATGAGAAGGAGGAGTAGGG - Intronic
1088844517 11:113653486-113653508 AGGAATGAGCATGGGAACACAGG - Intergenic
1088977762 11:114830953-114830975 AGGAATGAATTTGAGAAGAAAGG + Intergenic
1089168775 11:116498356-116498378 AGGAATGGCCATGAGGAGCCAGG - Intergenic
1089417684 11:118306193-118306215 AAGAAGGAGGAGGAGGAGAAGGG + Intronic
1089702599 11:120254586-120254608 AGGAATGGGGATGAGAGGAAGGG - Intronic
1090018787 11:123108675-123108697 AGGGAGGAGAATGAGGAAAAGGG + Intronic
1090080827 11:123611529-123611551 AGGAAGGAGGAAGAGGAGCAAGG - Intronic
1090555005 11:127864649-127864671 AGAGATGGGTATGAGGAGAAAGG + Intergenic
1091097806 11:132840440-132840462 ATGAATGAGAATGAGCAAAACGG - Intronic
1092090161 12:5797705-5797727 AGGAAGGAGCCTCAGGAGAATGG - Intronic
1092481241 12:8860985-8861007 AGGAATACGCATGAGAAGGAGGG - Intronic
1092589783 12:9941836-9941858 GAGAATGAGCATGAGGAGAATGG + Intergenic
1092669723 12:10849239-10849261 AGGAAGGAGGTTGAGAAGAAGGG - Intronic
1092796081 12:12111271-12111293 AGGAATGCTAATGAGGAAAATGG + Intronic
1094675501 12:32616138-32616160 ATTAATGAGGAAGAGGAGAAAGG - Intronic
1094677900 12:32639054-32639076 AGGAATGAGCATGAGGAGAAGGG + Intronic
1095517389 12:43021498-43021520 AGGAAGGAACAGGACGAGAAAGG + Intergenic
1095523510 12:43096530-43096552 AGGGAAAAGCAAGAGGAGAAAGG - Intergenic
1096567606 12:52494432-52494454 AGCACTGTGCATGAGGAGAATGG + Intergenic
1097456771 12:59808322-59808344 AGGAATTTGCAGGAGGAGCAGGG - Intergenic
1098541864 12:71665880-71665902 GGGAATGAACTTGATGAGAAAGG + Intronic
1098560858 12:71870246-71870268 AGGAAGGAGAAGGAGGAGAAGGG - Intronic
1098562221 12:71887505-71887527 AGAAATCTGCATGAGTAGAATGG - Intronic
1098606544 12:72397558-72397580 AGGGGTGAGCACAAGGAGAATGG - Intronic
1100128393 12:91458514-91458536 AGGAAAGTGCAAGAGGAGAATGG - Intergenic
1100130437 12:91486642-91486664 ATTATTGAGCATGAAGAGAAGGG + Intergenic
1100274266 12:93057755-93057777 ATGAGTGAGCTTGAGGAGCATGG - Intergenic
1100450636 12:94702425-94702447 GGGAATGAGCAAAAGGAGAGGGG - Intergenic
1100474139 12:94920115-94920137 AGGAATGAGGATAAGAAAAATGG + Intronic
1100679538 12:96903725-96903747 AGGAAATAGGAAGAGGAGAAAGG - Intergenic
1100752415 12:97713396-97713418 AGGAATGAAAATGAGGGCAAAGG - Intergenic
1100872129 12:98921134-98921156 AGGAATGAGGAAGAGGGGAAGGG - Intronic
1100875119 12:98953593-98953615 AGGAATGTGCATGAGGTGGAGGG - Intronic
1101188200 12:102304074-102304096 AGGAAAGTGAATGAGGAGCAAGG - Intergenic
1101696700 12:107133770-107133792 GGGAATGAGCATGTGGAGATGGG - Intergenic
1101763344 12:107677161-107677183 AAAAATGAGAATGAAGAGAAAGG + Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1102300479 12:111767373-111767395 AGCAAGGACCATGGGGAGAACGG - Intronic
1102408802 12:112698924-112698946 AAGAAGGAGGAGGAGGAGAAGGG - Intronic
1102436797 12:112930455-112930477 GGCAGTGAGCATGAGGAGAAGGG - Intronic
1102604986 12:114061481-114061503 TGGAATTAACATAAGGAGAAAGG - Intergenic
1102627266 12:114245090-114245112 AGCACTGAGCATGGGGAGAGAGG - Intergenic
1102636736 12:114331223-114331245 GGGGATGAGCATGAAGAGACAGG + Intergenic
1102792313 12:115657774-115657796 AAGAAGGAGGATGAGGAGGAGGG - Intergenic
1103138694 12:118529881-118529903 AGAAATGACGATGAGAAGAATGG - Intergenic
1103263148 12:119606386-119606408 AGGAATGAAGATGATGAGGATGG + Intronic
1103721582 12:122978286-122978308 AGGAAGTAACATGAGGAGCAGGG - Intronic
1104645759 12:130496265-130496287 GGGAATGAGAATCAAGAGAAAGG - Intronic
1105289712 13:19044645-19044667 AGGGATGAGCAGGTGGAGCACGG + Intergenic
1105564428 13:21530324-21530346 AGGAATGAGCATGATGAGAGGGG - Intronic
1105632343 13:22182852-22182874 ACAGATGAGCATGGGGAGAAGGG - Intergenic
1105724725 13:23151321-23151343 AATAATGAGAATGGGGAGAAGGG - Intergenic
1106035761 13:26043614-26043636 AGGCAGGAGAATGAGGAGAATGG + Intergenic
1106972129 13:35154084-35154106 AGGTATGAGAATGAGGGGAACGG + Intronic
1107198687 13:37686794-37686816 CACACTGAGCATGAGGAGAAAGG - Intronic
1107363285 13:39642635-39642657 AGGCATGAGCATGGTGAGGAGGG + Intergenic
1107897118 13:44976293-44976315 AGGAAGGAGAAGGAGAAGAAAGG + Intronic
1109066709 13:57703437-57703459 AGGAGTGAGCAAAAGGAGATTGG + Intronic
1109394199 13:61733816-61733838 AGGAATGAGGGTGAGGAAAATGG - Intergenic
1109948105 13:69464351-69464373 AGGTATGACCATGAGGATGAAGG - Intergenic
1110399293 13:75071045-75071067 AGGAAGCAGAATGAAGAGAAAGG - Intergenic
1110614379 13:77524737-77524759 AGGAATGGGTGTGAGCAGAATGG - Intergenic
1111125205 13:83906274-83906296 AGAAATGAGCAAGAGGAAAGTGG + Intergenic
1111937611 13:94572790-94572812 GGGATCGAGCATGAGCAGAATGG + Intergenic
1112394862 13:99020120-99020142 AAGAATGAGGGTGGGGAGAATGG + Intronic
1112607810 13:100924559-100924581 AGGAATGAGCTTTAGGAAAGAGG - Intergenic
1113122340 13:106937105-106937127 AAGGATGAGGAGGAGGAGAAAGG - Intergenic
1113134262 13:107072283-107072305 AGGAGTGGGCTCGAGGAGAAAGG - Intergenic
1113297966 13:108983229-108983251 AGGAGAGAGAAAGAGGAGAATGG - Intronic
1113486411 13:110655812-110655834 ATGAATGAGACAGAGGAGAAAGG + Intronic
1113595301 13:111527519-111527541 AGGAAGGAGGAGGAAGAGAAAGG - Intergenic
1114449605 14:22816400-22816422 AGGCAGGAGAATGAGGAGAATGG + Intronic
1114713446 14:24801657-24801679 TGGAAGCAGCAGGAGGAGAAGGG + Intergenic
1114726327 14:24941536-24941558 AGAAATGAGCAGGGGGAGGAGGG + Intronic
1115771294 14:36666084-36666106 AAGAATGAGGAGGTGGAGAACGG + Intronic
1115888514 14:38001215-38001237 AGGAGAGAGGATGAGAAGAAGGG - Intronic
1116626155 14:47266481-47266503 ATGATTGAGCATGAGGAGGCAGG - Intronic
1117058140 14:51933843-51933865 GAGAATGAGGATGAGGAGAAAGG + Intronic
1118197517 14:63641461-63641483 AGGAAAGAGCAGGAGGAAACAGG + Intronic
1118510155 14:66463481-66463503 AGGACTGTGTCTGAGGAGAAGGG - Intergenic
1118524997 14:66630139-66630161 AGGAATGGGGAAGAGAAGAAAGG + Intronic
1118923209 14:70168505-70168527 AGGAAAAGGCATGAGGAAAAAGG + Intronic
1119067410 14:71542665-71542687 AGGAAGGAGGAGGAGGAGGAGGG - Intronic
1119123018 14:72097567-72097589 AAGAATGAAGAGGAGGAGAAGGG + Intronic
1120058211 14:79950372-79950394 AGGAAGGGGCTTGAGGAGGAAGG - Intergenic
1120143144 14:80951220-80951242 AGGAATGAGAAAGACCAGAAGGG + Intronic
1120387399 14:83863593-83863615 AGGAAGCATCATAAGGAGAATGG - Intergenic
1120484786 14:85099384-85099406 AGGAAAGAGAAAGAAGAGAATGG + Intergenic
1120513380 14:85442208-85442230 AGGAATAAGCAAGAGCAGGAAGG + Intergenic
1120932343 14:89861481-89861503 AGGAAGGGACATGATGAGAAAGG - Intronic
1121248711 14:92483703-92483725 GGGAATGAGGAGGAGAAGAAGGG - Intronic
1121604468 14:95230497-95230519 AGTGATGGGCATGAGGAGATGGG + Intronic
1121631661 14:95425452-95425474 AGGGATGAGTAGGTGGAGAACGG + Intronic
1121735723 14:96216730-96216752 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1122285808 14:100651791-100651813 AGGAATGAACAGCAGGAGACAGG - Intergenic
1122435321 14:101691352-101691374 AGGAATGGGCTTTAGGTGAAAGG - Intergenic
1122589488 14:102836996-102837018 AGGAAAGAGCAAGGGGAGAATGG - Intronic
1123754316 15:23385039-23385061 AGGAGTTAGGATGAGGAGACCGG - Intergenic
1123755573 15:23395283-23395305 AGGAATGAGCAAATGGAAAAGGG - Intergenic
1123976835 15:25561609-25561631 AGGAAGGAACAAAAGGAGAAGGG + Intergenic
1123978654 15:25578199-25578221 AGCAATGAGCCTCAGGAGAAGGG - Intergenic
1124416338 15:29475652-29475674 AGAAATGAGGAGGAGGAGGAAGG + Intronic
1125293404 15:38175060-38175082 AGAAGAGAGCATGAGGAGACTGG - Intergenic
1127852570 15:62926649-62926671 GGCAATCAGGATGAGGAGAACGG - Intergenic
1128313125 15:66644154-66644176 AGGGCTGAGCATGTAGAGAATGG + Intronic
1128533909 15:68475588-68475610 AAGAATGAGGAGGAGCAGAAGGG - Intergenic
1128981462 15:72190450-72190472 AGGAAGGAACATGAGGACAAAGG - Intronic
1129230921 15:74196848-74196870 AGGCATGATCCTGAGGAGATGGG - Intronic
1129782504 15:78282367-78282389 AGGAATGGGAATGAGTAGAAGGG + Intronic
1129907969 15:79203036-79203058 AGGAATAAGGATCAGGAGAGAGG + Intergenic
1130298663 15:82664382-82664404 CAGGATGAGGATGAGGAGAAAGG - Exonic
1130924674 15:88375960-88375982 AGGAATGAGGAAGAGAAGGAAGG - Intergenic
1131213297 15:90516322-90516344 AGGAAGGAGGAAGGGGAGAAAGG + Intergenic
1131695385 15:94871654-94871676 AGGAATAACAATGAGAAGAAAGG - Intergenic
1131901065 15:97088523-97088545 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901083 15:97088587-97088609 AGGAAAGAGGAGGAGGAGGAAGG - Intergenic
1131901098 15:97088639-97088661 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901103 15:97088655-97088677 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1132841299 16:1979602-1979624 AGCAAGGAGAATGTGGAGAAGGG - Exonic
1132845981 16:2001096-2001118 AGGAGTGAGGATCAGGAGGAAGG - Exonic
1133392735 16:5422702-5422724 AGGAAAGAGAAAGAGGAGGAGGG + Intergenic
1133394981 16:5439569-5439591 AGGAATGAGAAGGCAGAGAAAGG + Intergenic
1133885736 16:9825962-9825984 TGGAAGGAGTAGGAGGAGAAGGG + Intronic
1134423061 16:14112337-14112359 GGGAATGATCATGAGGTGAGTGG + Intronic
1134460803 16:14427742-14427764 AGGAATGAGCAAATGGAAAAGGG + Intergenic
1135303576 16:21350661-21350683 CGGAATGAGGAAGAGGTGAAAGG + Intergenic
1135755185 16:25091468-25091490 ACTAAAGAGCATGGGGAGAAGGG + Intergenic
1136300322 16:29329856-29329878 TGGAATGAGGATGAGGTGAAAGG + Intergenic
1137071873 16:35910717-35910739 AGGACTGAGCCTGAGGAGGGAGG + Intergenic
1137400076 16:48146238-48146260 AGGAATGTCCATCAGGAGAGTGG - Intronic
1137801283 16:51264270-51264292 AAGAGTGAACATGAGGATAATGG - Intergenic
1137841070 16:51641336-51641358 AGGAATGAGCAACAGGAAAAGGG + Intergenic
1137859341 16:51830547-51830569 AAGAATGAGAAGAAGGAGAAGGG - Intergenic
1137895314 16:52205645-52205667 ATGTATGAGCATGAGGAGAGGGG - Intergenic
1137955593 16:52825713-52825735 TGGAGTGAGCAAGAGGAGAGTGG - Intergenic
1138153944 16:54685793-54685815 AGGAAGAAGGAGGAGGAGAAAGG - Intergenic
1138423436 16:56914784-56914806 AGGAATGAAGATGTGGAGAGGGG + Exonic
1138485400 16:57339599-57339621 AGGAATGAGAATGAAGTAAAAGG + Intergenic
1139946334 16:70644925-70644947 AGGAAGGAGGAAGAGGAGGAAGG + Intronic
1140945169 16:79761324-79761346 GGGTATGAGAATGAGGAGAGGGG - Intergenic
1141116215 16:81312117-81312139 TGGAATGACCATCAAGAGAAAGG - Intergenic
1142062051 16:88036620-88036642 CGGAATGAGGATGAGGTGAAAGG + Intronic
1142422305 16:89979379-89979401 AGGCAGGAGAAGGAGGAGAATGG - Intergenic
1142447544 16:90151152-90151174 AGAAATGAGCATGGTGGGAATGG + Intergenic
1142503094 17:344921-344943 AGGAATCAGCATGAGGGGAAAGG + Intronic
1144477869 17:15604414-15604436 AGGAAGAAGCAAGAAGAGAAGGG + Intronic
1144920426 17:18759276-18759298 AGGAAGAAGCAAGAAGAGAAGGG - Intronic
1146002613 17:29140281-29140303 AGGAAATAGCATGAGGAGCCTGG + Intronic
1147120859 17:38334399-38334421 AGGACTGAGCATGTGTGGAAAGG + Intronic
1147391427 17:40111736-40111758 AGGGATGACCCTGAGCAGAAGGG - Intergenic
1147774380 17:42890225-42890247 AGGAAGGAGGAGGAAGAGAAAGG + Intergenic
1148031925 17:44627782-44627804 AGGAGGGAGCATGGGGAGATGGG + Intergenic
1148046399 17:44747641-44747663 AGGACTGAGGATAAGGGGAAAGG - Intronic
1148676809 17:49450582-49450604 AGACATGTGCATGAGAAGAATGG + Intronic
1149563777 17:57627738-57627760 AGGACGGAGCAGGAGGAGGAGGG - Intronic
1149572844 17:57685880-57685902 AGCAATCAGGATGAGGAGCATGG - Intergenic
1150890545 17:69144248-69144270 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1151418193 17:73980452-73980474 GGGAAGGATAATGAGGAGAAAGG + Intergenic
1151507461 17:74539087-74539109 AGGCATGAGAAGGTGGAGAAGGG - Intergenic
1151507538 17:74539453-74539475 AGGGATGAGTAAGAGCAGAAGGG - Intergenic
1151509003 17:74546915-74546937 AGGCATGAGAAGGTGGAGAAGGG - Intergenic
1153248962 18:3101435-3101457 TAAAATGAGCATGGGGAGAATGG - Intronic
1154031321 18:10756460-10756482 AGCTATGAGGATGAGGAGGAGGG + Intronic
1154031359 18:10756657-10756679 AGCTATGAGGATGAGGAGGAGGG + Intronic
1155170727 18:23265220-23265242 ATGAGAGAGCAGGAGGAGAACGG + Intronic
1155347730 18:24875339-24875361 AGGAAAGGGCATGGGGATAAGGG + Intergenic
1155591625 18:27434034-27434056 AGGAAAGAGGAAGAAGAGAAAGG + Intergenic
1156487500 18:37475838-37475860 AGAAATGAGTAAGAGGAGGAAGG - Intronic
1157602881 18:48905098-48905120 AAGAAAGAGAAGGAGGAGAAAGG + Intergenic
1157811876 18:50703168-50703190 GGGAGTGAGCATGGGGAGGAGGG - Intronic
1157934532 18:51858569-51858591 AGGATAGAGCAGGAGCAGAAGGG - Intergenic
1158613346 18:58962991-58963013 AGCAATGAGCATCAGCAGCAAGG - Intronic
1158786000 18:60712467-60712489 AGGAACTAGAATTAGGAGAAGGG + Intergenic
1158963812 18:62606959-62606981 AAGAAGGAGGAGGAGGAGAAGGG + Intergenic
1159424088 18:68261328-68261350 GGGAATGGGCAGGAGGAGAAAGG + Intergenic
1159473552 18:68888228-68888250 ATGAATGAGCACAAAGAGAAGGG + Intronic
1159702490 18:71646423-71646445 TGGAAGCAGCATGAGGAGAAAGG - Intergenic
1159982858 18:74807203-74807225 AGGAACGTGAATGATGAGAAAGG + Intronic
1160649664 19:216679-216701 AGAAATGAGCATGGTGGGAATGG - Intergenic
1161042006 19:2115310-2115332 AGGAAGGAGAAGGAGAAGAAGGG - Exonic
1161163175 19:2771889-2771911 CGGAAGGAGCAGGTGGAGAAGGG - Intronic
1161863043 19:6812854-6812876 AAGAATGGTGATGAGGAGAATGG + Intronic
1161933701 19:7357848-7357870 ATGAAAAAGCATGAGCAGAATGG - Intronic
1163314275 19:16531706-16531728 AGGCATGAGGAGGAGCAGAAGGG + Intronic
1163622502 19:18369291-18369313 GAGAAAGAGCAGGAGGAGAAAGG - Exonic
1163761619 19:19140073-19140095 GGGACTGAGCAAGAGGAAAAGGG - Intergenic
1164149301 19:22535322-22535344 AGGAATGAGGATGAGGAAACTGG - Intergenic
1164155440 19:22593766-22593788 AGGAATGAGGATGAGGAAACTGG + Intergenic
1164592072 19:29512663-29512685 AGGAAGGGGGATGAGGAGGAAGG + Intergenic
1165203968 19:34168248-34168270 AGTGATGAGCATAAGGAGAACGG - Intergenic
1165206382 19:34191851-34191873 AGGAAGGATAAGGAGGAGAAAGG - Intronic
1165363346 19:35350190-35350212 AGGAAGGAGCGGGAGGAGGAAGG - Intergenic
1165384907 19:35504680-35504702 AGGAAGGAGATTGAGGAGACAGG - Intronic
1166241690 19:41499119-41499141 AAGAATGAGGATGAAGAGGAGGG + Intergenic
1167139215 19:47638113-47638135 AAGAAAGAGCAGGAGGAGGAGGG - Intronic
1167142370 19:47660854-47660876 TGTAATGGGCATGAGGATAATGG + Intronic
1167419891 19:49396607-49396629 AGGAGTGAGCATGGGGAGCAAGG - Intronic
1168503093 19:56909946-56909968 AGGAATGAGCTGGAGGAGTCTGG + Intergenic
925237786 2:2294138-2294160 AGGAATGAGGAACATGAGAATGG + Intronic
926094005 2:10069110-10069132 AGGGATGAGCAGGCGGAGACAGG + Intronic
927417144 2:22891347-22891369 AGGAAAGAGCAGGAGGACCATGG + Intergenic
927442010 2:23125581-23125603 AGGAAAGTGAATGAGTAGAAAGG - Intergenic
928248835 2:29656832-29656854 AGGATGGAGAATGAGGAGCAAGG - Intronic
929024417 2:37585838-37585860 ATGATTGAGCATGGGGAGAGGGG - Intergenic
929928742 2:46235932-46235954 AGAAATGGGTATGGGGAGAAAGG + Intergenic
930166183 2:48205825-48205847 CGGAAGGAACAGGAGGAGAAGGG + Intergenic
930253388 2:49061006-49061028 AGGTATGGGCAGGGGGAGAAAGG - Intronic
930540862 2:52704853-52704875 AGGAATGGGCATCTGGAAAAGGG + Intergenic
930708515 2:54527934-54527956 AGAAAAGAGGAAGAGGAGAATGG + Intronic
931007196 2:57865234-57865256 AAGAAAGAGGAAGAGGAGAATGG + Intergenic
931238684 2:60433383-60433405 AGGCATGGGCATGACCAGAAAGG + Intergenic
932880918 2:75501170-75501192 AGGGATGAACATGAAGAGGAGGG - Intronic
933635505 2:84704387-84704409 AGCAATGAGAAGGTGGAGAAGGG - Intronic
934037938 2:88104284-88104306 AAGAAGGAGGAAGAGGAGAAGGG - Intronic
934780720 2:96968222-96968244 GGGAATGAGCAGGAGCAGAGGGG - Intronic
935026428 2:99281625-99281647 AAGAAAGAGAATGAGGAGAAGGG + Intronic
935152628 2:100451207-100451229 GGGAAGGAGCTGGAGGAGAAGGG - Intergenic
935171628 2:100614814-100614836 CGGGATGAGCATGAGGACTAGGG + Intergenic
935414934 2:102805354-102805376 AGGAATGAGAATGTGAAGAGAGG + Intronic
935488384 2:103686607-103686629 AAGAAGGAGGAGGAGGAGAAGGG + Intergenic
935531665 2:104240362-104240384 AGGGAGGAGGATGAGGAGGAGGG + Intergenic
935801765 2:106704587-106704609 AGGAAAGAGGATCAGGAGGAAGG - Intergenic
935953505 2:108352244-108352266 GGGAAGGAGCAAGAGGAAAATGG - Intergenic
936379409 2:111970751-111970773 AGGGAGGAGGAGGAGGAGAAGGG - Intronic
936567462 2:113592184-113592206 GGGAATGAGGATGAAGGGAAGGG + Intergenic
936700002 2:115000039-115000061 AGGGATGGTCATGAGGAAAAAGG - Intronic
936889430 2:117351621-117351643 AATAACCAGCATGAGGAGAATGG + Intergenic
937719916 2:125082123-125082145 AGGAATAAGCAAGAGAAAAAGGG - Intergenic
938079910 2:128364483-128364505 TGGAAGGAGCAAGAGGAGAAGGG - Intergenic
938251780 2:129821343-129821365 CGGGCTGAGCATGAGGGGAAGGG - Intergenic
938560938 2:132471293-132471315 ATCAATGAGTATGAGGAGACAGG - Intronic
939373092 2:141328440-141328462 AGGATTGAGCATGAGGAGAGAGG - Intronic
939656342 2:144830757-144830779 AGAAATATGCAGGAGGAGAAGGG + Intergenic
939869672 2:147512846-147512868 AGGAAGGAGTATGAGTAGAAAGG + Intergenic
940805013 2:158177365-158177387 AAGAATTAGCATGAAGAAAATGG + Intronic
940879186 2:158929449-158929471 AAGGATGAGCAGGAGGAGGAAGG - Intergenic
941493617 2:166173599-166173621 TGGAATGAGCATAGGGCGAAGGG - Intergenic
941772577 2:169361108-169361130 GGGAAGGAGCAGGAGGGGAAAGG + Intronic
941776259 2:169396673-169396695 TGGAAGGAGGAGGAGGAGAAGGG + Intergenic
942348850 2:175031655-175031677 AGGAGTCAGCATGAGGAGCTTGG + Intergenic
942440973 2:176036344-176036366 AGTGATGATCAGGAGGAGAAAGG + Intergenic
942617020 2:177802455-177802477 AGTATTGATCAAGAGGAGAATGG + Intronic
942714904 2:178881127-178881149 AGGAAAGTGAATTAGGAGAAAGG + Intronic
942783674 2:179675627-179675649 AGGCAAGAGCAGGAGGAAAAGGG + Intronic
943280639 2:185928443-185928465 AGGAAGGAGGAAGAGAAGAAGGG + Intergenic
944329281 2:198446023-198446045 ATGAATGAAAATGAAGAGAATGG + Intronic
945018215 2:205542479-205542501 ATGAATGAAGTTGAGGAGAAAGG - Intronic
945301780 2:208221460-208221482 AGCAAAGAGCAGGAGGACAAGGG + Intergenic
945381964 2:209150904-209150926 AGGAAGGATTAGGAGGAGAATGG - Intergenic
945494073 2:210488772-210488794 AGGAATGAGGAAGAGGAGATAGG - Intronic
945563858 2:211371512-211371534 GGGAAGGAGAATGAGGATAAAGG + Intergenic
945889024 2:215408920-215408942 AAGAAGGAGGAGGAGGAGAAAGG - Intronic
946037710 2:216756951-216756973 AGGAATATGCAAGATGAGAAGGG - Intergenic
946096171 2:217275786-217275808 AGGCCTGAGCATCTGGAGAAGGG - Intergenic
946937864 2:224740051-224740073 AGGAAGGGGCATAAGGAGAGAGG - Intergenic
947151937 2:227124497-227124519 ATGAATGAGCATGAAGAAAAGGG - Intronic
947270161 2:228325890-228325912 AAGAATGAGTAAGAAGAGAAAGG + Intergenic
947402020 2:229740803-229740825 AGGAATCTGGATGAGAAGAATGG + Intergenic
947831026 2:233141813-233141835 AGGGATGAGACTGGGGAGAAGGG + Intronic
948143528 2:235691830-235691852 AGGGATGAGCTTGGGGACAATGG + Intronic
948546333 2:238731757-238731779 CGGAATGGGCAGGTGGAGAATGG + Intergenic
1169091388 20:2863239-2863261 AGGAGTGAGGTGGAGGAGAAAGG - Intronic
1169648607 20:7842214-7842236 ACCAATGAGCATTAGAAGAATGG + Intergenic
1171074686 20:22110611-22110633 AGGAAAGAGGAAGAGGAGGAGGG - Intergenic
1171074695 20:22110648-22110670 AGGAAAGAGGAAGAGGAGGAGGG - Intergenic
1171295793 20:24015820-24015842 GGGAGTGGGCATGAGGACAAGGG - Intergenic
1171918236 20:31076899-31076921 AGGAATGGACATGAAAAGAATGG + Intergenic
1171926724 20:31194987-31195009 AGGAATGGACATGAAAAGAATGG + Intergenic
1171941135 20:31330984-31331006 AAGAAGGAGCAAGAGGGGAAGGG + Intergenic
1172957538 20:38771652-38771674 AGGAAAGAGTATGAAGAAAAGGG + Exonic
1173199971 20:40947253-40947275 AGGATTCAGCATCAGGAAAAAGG + Intergenic
1173761141 20:45561683-45561705 AGGCATGAGCCTGAGGGGAGAGG - Intronic
1173957034 20:47041261-47041283 AGGAAAGAGCATGGGGAGGGAGG - Intronic
1174044832 20:47726053-47726075 AGGGATGAGGAGGAGGAGATTGG + Intronic
1174705895 20:52655868-52655890 TGGATTGAGCATGAGGAAATAGG - Intergenic
1175238452 20:57528615-57528637 AGGGATGAGGAGGAGGAGAGAGG + Intergenic
1176054550 20:63137079-63137101 AGGAAAGAGCATGGGCAGAGAGG + Intergenic
1176669620 21:9720833-9720855 AGGAATGAGCAGGAGCAGAATGG + Intergenic
1178152885 21:29816302-29816324 ACTGATGAGGATGAGGAGAAAGG + Intronic
1178490340 21:33046733-33046755 AGGAACGTGCATATGGAGAACGG - Intergenic
1178709435 21:34901650-34901672 ACCAAAGAGCATGTGGAGAAGGG - Intronic
1178726702 21:35058835-35058857 AGAAAGGAGTAGGAGGAGAAAGG + Intronic
1178989395 21:37340178-37340200 AGGAATGAGAAACAGGAAAAGGG - Intergenic
1180104436 21:45608647-45608669 AGCATTTAGCAAGAGGAGAATGG - Intergenic
1181764839 22:25083964-25083986 AGGAATGAACTGGAGGACAAAGG - Intronic
1182045460 22:27270723-27270745 AGAAAGGAGGGTGAGGAGAAGGG + Intergenic
1183150588 22:36034129-36034151 AGGATGGAGTAAGAGGAGAATGG - Intergenic
1183251196 22:36731687-36731709 TGGACTGAGCATGAGGAGGATGG - Intergenic
1183254802 22:36755566-36755588 AGGAAGGACTATGAGAAGAAGGG - Intergenic
1183631576 22:39036206-39036228 AGGGAGGGGCATGAGCAGAAGGG - Intergenic
1184313114 22:43661464-43661486 AGGACAGACCATGAGGTGAATGG + Intronic
1184412308 22:44332256-44332278 AGGAAGGAAAATGAGGAGGAAGG - Intergenic
1184449772 22:44576007-44576029 AGGAAGGAGGAAGAGGAGGAGGG + Intergenic
1184863264 22:47188913-47188935 AGGAGGGAGCCTGAGGAGGAGGG + Intergenic
1184868648 22:47219337-47219359 AGGCAGGAGAATGGGGAGAATGG - Intergenic
949670846 3:6398089-6398111 AGCAAAGAGCAGGAGGACAAGGG - Intergenic
950397263 3:12743095-12743117 AGGAAAGAGCATGGGGAAAAGGG - Intronic
950648621 3:14393306-14393328 AAGAATGAGCAAGAAGAGAGGGG - Intergenic
950759763 3:15210983-15211005 TGGAATGGTGATGAGGAGAATGG + Intronic
951119014 3:18901545-18901567 AGGAGTGAACATCAGGAGGAGGG + Intergenic
951316470 3:21193734-21193756 AGCAAAGAGCAAGAGGAGAGGGG + Intergenic
951590358 3:24258108-24258130 AGGGAGGAGAATGAGGTGAAAGG + Intronic
951730084 3:25800560-25800582 AGGAAAGGGAATGAGGAAAAGGG - Intergenic
951979284 3:28547971-28547993 ATGCATGGGCAGGAGGAGAATGG + Intergenic
952574302 3:34756131-34756153 AAGAATGAACATTAGGAGAATGG - Intergenic
952626247 3:35407513-35407535 AGGAATGTTCAAGAGGAAAAAGG + Intergenic
952809772 3:37391424-37391446 AGAAAGGAGAAGGAGGAGAAAGG + Intronic
953182550 3:40609676-40609698 AGAAATGTGCATCATGAGAAAGG - Intergenic
953525380 3:43686105-43686127 AGGAATGAGGAAGAGGAGCATGG - Intronic
955080489 3:55653965-55653987 AGGAATGAGGAGGAAGAGGAGGG - Intronic
956095219 3:65708857-65708879 GGTGATGAACATGAGGAGAAAGG + Intronic
956735415 3:72233999-72234021 AGGAAAGAGGATCAGGAAAAGGG - Intergenic
957336203 3:78832269-78832291 AGGAAAGAGACTGTGGAGAAAGG - Intronic
957396548 3:79646415-79646437 ACTAACGAGCATGTGGAGAAAGG + Intronic
957637587 3:82806873-82806895 TGTAATGATCATGATGAGAATGG - Intergenic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960476310 3:118133237-118133259 AGGGGTGAGCAGGAAGAGAAGGG + Intergenic
960574949 3:119220358-119220380 AGCAATCAGCATGAGAACAAGGG + Intronic
960910033 3:122640407-122640429 AGGAATAAGAAGGAGAAGAATGG - Intergenic
960928627 3:122821439-122821461 AGGAGTCAGTATGAGGAGACTGG + Intronic
961440486 3:126949827-126949849 AGGAATGTTAATGACGAGAAGGG + Intronic
961572344 3:127808731-127808753 AGGAATGAGCAGGAGAAGAGAGG - Intronic
961978931 3:131056068-131056090 ATGAATGAGGGTGGGGAGAAGGG + Intronic
962280624 3:134049144-134049166 GGAAAGGAGAATGAGGAGAATGG - Intronic
962426192 3:135271254-135271276 AGGAAGGGGTATGAGGAGACAGG - Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963294414 3:143529941-143529963 AAGAATGAGAATGAGGAAACTGG + Intronic
963932970 3:151023453-151023475 AGGAAGGAGAAAGAGGAGAAAGG + Intergenic
964568155 3:158081025-158081047 TGAAGTGAGGATGAGGAGAAGGG + Intergenic
964963605 3:162460714-162460736 AGGAAGAAGCATGAGAAAAAAGG + Intergenic
964968521 3:162529421-162529443 AGGAAAGAGAATTCGGAGAAGGG - Intergenic
965505707 3:169512516-169512538 AATATTGGGCATGAGGAGAACGG - Intronic
965598222 3:170428622-170428644 AAAAATGAGAAGGAGGAGAAGGG - Intronic
967983553 3:195079448-195079470 AGGAATGAGAATAACGATAATGG + Intronic
968368186 3:198203456-198203478 AGAAATGAGCATGGTGGGAATGG + Intergenic
968914350 4:3490741-3490763 AGGAATGAGCAGGAGGAAGAAGG - Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969511386 4:7620017-7620039 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
969511391 4:7620033-7620055 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
969657690 4:8507567-8507589 AAGAAGGAGAAAGAGGAGAAAGG - Intergenic
970723614 4:19016809-19016831 AGCAAAGAGCAGGAGGACAAGGG - Intergenic
971192627 4:24441762-24441784 AGGAAGGAGAAAGAAGAGAAAGG + Intergenic
971420260 4:26467920-26467942 AGGAAGGAGAAGGAGGGGAAGGG + Intergenic
971756745 4:30717560-30717582 AGGAATGAGAGTGAGGAGGGCGG + Intergenic
972169176 4:36324128-36324150 AGGAATGGGGGGGAGGAGAAGGG - Intronic
972203380 4:36742378-36742400 AGGATTGAGGATAGGGAGAAAGG - Intergenic
972261075 4:37408561-37408583 GGGACAGAGCATGAGGGGAAAGG + Intronic
973356882 4:49137744-49137766 AGGAATCACCATGAGTGGAATGG - Intergenic
973357314 4:49140243-49140265 AGGAATCACCATGAGTGGAATGG - Intergenic
973357735 4:49142682-49142704 AGGAATCACCATGAGTGGAATGG - Intergenic
975794709 4:77994958-77994980 AGGAATGTGGAAGAGAAGAAAGG + Intergenic
976160538 4:82193813-82193835 AGGAAGGAGCTCCAGGAGAAGGG - Intergenic
976375889 4:84344178-84344200 AGGCAGGAGGCTGAGGAGAACGG + Intergenic
976571898 4:86621872-86621894 AGGAGGGAGGATGAGGAGAGAGG - Intronic
977422980 4:96827381-96827403 AGATATGAGCATAAGGAAAAAGG + Intergenic
977718113 4:100207024-100207046 AGAAATGAGGATGAGGAAACTGG + Intergenic
977820112 4:101461395-101461417 AGGAGTAGGAATGAGGAGAATGG + Intronic
978079512 4:104574917-104574939 AGGTATCAGCAAGAGGATAATGG + Intergenic
978172429 4:105689275-105689297 AGGAATCTGTTTGAGGAGAAAGG + Intronic
978245491 4:106567399-106567421 AGAAAGGAGAATGAGAAGAAAGG - Intergenic
978954041 4:114594208-114594230 AGGATTGTGCATTAGGAAAATGG + Intergenic
979192400 4:117878013-117878035 AGGAATGCGGAAGAAGAGAAAGG - Intergenic
979256614 4:118613180-118613202 AGAAATGAGCATGGTGGGAATGG + Intergenic
979331735 4:119427365-119427387 AGAAATGAGCATGGTGGGAATGG - Intergenic
980484592 4:133439269-133439291 AAGAAGGAGAAGGAGGAGAAGGG + Intergenic
980588869 4:134856863-134856885 AGTACTGAGCATGAATAGAAGGG + Intergenic
980701903 4:136442446-136442468 AACAATGAGCATGGGGAGTAGGG + Intergenic
980844915 4:138312817-138312839 AGGAAGGAGGAGGAGGAGAAAGG - Intergenic
981237099 4:142431224-142431246 AGGAAGGGGCATCAGAAGAAGGG - Exonic
982080161 4:151781806-151781828 ATGAATTAGCATTAGGAAAAAGG + Intergenic
982321731 4:154083917-154083939 TTGAAACAGCATGAGGAGAATGG - Intergenic
982566287 4:156991214-156991236 ACTAATTAGCATGAGGAGATAGG + Intergenic
982752317 4:159177029-159177051 AAGATTGAGAAAGAGGAGAATGG - Intronic
983322475 4:166212012-166212034 AGCAATGTGCATGAGTAGCAAGG - Intergenic
985296801 4:188444772-188444794 AGGAAACAGCATGAGGACAGGGG + Intergenic
985405155 4:189630632-189630654 AGGAATGAGCAGGAGCAGAATGG - Intergenic
986382981 5:7205405-7205427 AGGAATGACCATGAGCATGAGGG + Intergenic
987049285 5:14135993-14136015 GGGAATGGGCATGGGGAGCAGGG - Intergenic
987455101 5:18134566-18134588 AGAAATGAGCTTGTGGGGAAGGG + Intergenic
987580079 5:19778802-19778824 AGATATCAGCATGAGGAGATGGG - Intronic
987769187 5:22277965-22277987 AGGAATGACCTTGTGGAAAAAGG + Intronic
989129521 5:38092854-38092876 AAGAATGAGAAAGAGAAGAAGGG - Intergenic
989164545 5:38421792-38421814 AGGAGTGAAAATGTGGAGAAGGG + Intronic
989756207 5:44958710-44958732 AGGAAGGAGAAGGAAGAGAAAGG - Intergenic
990554558 5:56918179-56918201 TGGAGTGAGCAAGGGGAGAAAGG - Intergenic
990681522 5:58249897-58249919 AGGAAGAAGGAAGAGGAGAAGGG + Intergenic
990821972 5:59851478-59851500 AGGCCTGAACATGAGGAGATGGG - Intronic
991201985 5:64005470-64005492 AGGAATCAGCATGAATATAAAGG + Intergenic
992265996 5:75018809-75018831 AGGAATGAACATTAGGAGTAAGG + Intergenic
992275875 5:75117626-75117648 AGGTTTGAGCATGAGGGAAAAGG + Intronic
992556894 5:77912843-77912865 AGGAATGTGAAGGAGGAGGAGGG - Intergenic
993536978 5:89098617-89098639 GGGAAGGAGGATGAGAAGAAAGG - Intergenic
994243434 5:97450505-97450527 ATACATGAGCATGAGGAAAATGG - Intergenic
994942832 5:106346788-106346810 AGGCATGCGCCTGGGGAGAACGG - Intergenic
995235844 5:109829334-109829356 AGGAATGAGCAGGAGCATTATGG + Intronic
996587899 5:125111292-125111314 AGGATTGAGCATGAAAGGAAAGG - Intergenic
996938709 5:128977521-128977543 GGGAATGAGCAGGAGGAGAAAGG + Intronic
997206771 5:132054778-132054800 AGGAAGAAGGATGAGGAGGAGGG + Intergenic
997277607 5:132609910-132609932 AAGATTGAGAATTAGGAGAAGGG - Intronic
997293522 5:132754854-132754876 AGGAATGAGGCTGAAGAAAATGG + Intronic
998256048 5:140589398-140589420 AGGGAAGAGAATGAGCAGAATGG + Intronic
998416766 5:141951834-141951856 AGGAATGAGTATGAGGGGACAGG - Intronic
998996987 5:147876613-147876635 AGGAATGAAAGTGAAGAGAAAGG + Intronic
999430913 5:151524701-151524723 GGGAATGAGGCTGAGGAGATAGG - Intronic
999452952 5:151692111-151692133 AGGAATGAACAACAGGAAAATGG - Intergenic
999839870 5:155413372-155413394 AAGTATGAGTTTGAGGAGAAGGG + Intergenic
1000152163 5:158513931-158513953 AGGAAAGAACATCAGGAGAGAGG + Intergenic
1000627426 5:163555216-163555238 AAGGATGAGCAGGAGGTGAAGGG - Intergenic
1000707058 5:164525480-164525502 AGGAATGAGAATGAGGACCTGGG + Intergenic
1001001939 5:168015739-168015761 AGGAATGAGGATGAGAAAAACGG - Intronic
1001516343 5:172357840-172357862 AGAAAAGAGGATGAGGAGAAGGG - Intronic
1001754406 5:174157287-174157309 AGGGATGAGCATGGGGATACTGG + Intronic
1002288981 5:178187076-178187098 AGGGAGGAGCATGAGGAGGAGGG - Intergenic
1002438272 5:179247349-179247371 AGGAAAAAGAATGAGGAAAAAGG + Intronic
1002727406 5:181308683-181308705 AGAAATGAGCATGGTGGGAATGG + Intergenic
1002818371 6:699033-699055 AGGAAAGAGCAGGAGGGGAGTGG - Intergenic
1002920187 6:1563340-1563362 AGGCATGAGCAAGAAGAGTACGG - Intergenic
1003291698 6:4784943-4784965 AGGAAGGTGAATGAGGAGCAAGG - Intronic
1003495835 6:6662439-6662461 AGGAATAAGCAAGATTAGAAGGG - Intergenic
1003712232 6:8605077-8605099 AAGAATGAGAGGGAGGAGAAAGG - Intergenic
1003781126 6:9428294-9428316 GGAAATAACCATGAGGAGAAAGG + Intergenic
1004280679 6:14276998-14277020 AAAGATGAGCAGGAGGAGAAGGG - Intergenic
1005885299 6:30092832-30092854 AGGAATGAGGATCAGGAGTCGGG + Intergenic
1006497155 6:34431983-34432005 AGGAAAGAGCTTGAGCTGAAAGG + Intergenic
1006715571 6:36117398-36117420 AGGAATGAGGAGGAGGAAGAGGG - Intergenic
1007427254 6:41755603-41755625 AAGAAGGAGGAGGAGGAGAAGGG + Intergenic
1007582117 6:42965949-42965971 AGGAATGATCATGAGTAGCCTGG + Intronic
1008552221 6:52644261-52644283 AGGAATGGGCTTGGGGAGGAAGG - Intergenic
1008867412 6:56229648-56229670 AGGATTGAGTCTGAGGAGTATGG + Intronic
1008901276 6:56619736-56619758 AGGAAGGATCAGGCGGAGAAAGG - Intronic
1009645835 6:66400026-66400048 AGGAATGAGGAGGGGGAGACAGG + Intergenic
1009656862 6:66558561-66558583 AGGAATGAGCATGAGCTCAAAGG + Intergenic
1010658202 6:78537606-78537628 AGAAATGAGGATGATGAGGATGG + Intergenic
1010871170 6:81042466-81042488 GGCATTGAGCAGGAGGAGAAAGG + Intergenic
1011484752 6:87829988-87830010 AGGAAGGAGGAGGAGGAGAAGGG - Intergenic
1011869636 6:91876504-91876526 AGGTAAAAGCATAAGGAGAAGGG + Intergenic
1012853606 6:104475363-104475385 AGGCATGAGTATGAGGAGGTGGG + Intergenic
1014013991 6:116508525-116508547 GGGAGTGAGCATGAGGTCAAGGG + Intronic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1014724005 6:124954267-124954289 AGGAAGGAGAGAGAGGAGAAGGG - Intergenic
1015559837 6:134502851-134502873 AGGAATGGGCATGAATAGACTGG + Intergenic
1015744079 6:136490931-136490953 AGGAGTGATTATGGGGAGAAGGG - Intronic
1015944482 6:138486148-138486170 AGGAGTCAGCAGGAGGGGAAAGG - Intronic
1016848799 6:148595347-148595369 AGGAATGACAATGAGGATGATGG - Intergenic
1017041864 6:150314416-150314438 AGGGAGGAGGAGGAGGAGAAAGG + Intergenic
1017770101 6:157638298-157638320 AGGAAGGAGTAGGAGGAGGACGG - Intronic
1017964971 6:159256270-159256292 GGGAATGAGCAAGAGAAGTAGGG + Intronic
1018267802 6:162043768-162043790 AGGAAGCAGCAGGAAGAGAAAGG + Intronic
1018371132 6:163169649-163169671 AGGAATTAGCAGGAGGAGTGTGG + Intronic
1018463639 6:164022573-164022595 AAGAAGGAGGAAGAGGAGAATGG + Intergenic
1018559087 6:165082555-165082577 GGGGATGAGGTTGAGGAGAATGG + Intergenic
1018620497 6:165725633-165725655 AAGAATGAGCATCAGGAGACAGG - Intronic
1018945808 6:168346071-168346093 AGCTATGAGCATGAGGAGCCAGG + Intergenic
1020019949 7:4859581-4859603 AGGAAGGAGAATGAGGGGTACGG - Exonic
1021211974 7:17864770-17864792 AAGAAGGAGAAGGAGGAGAAGGG + Intronic
1021277952 7:18679032-18679054 AGGAATGAAGATGGAGAGAAAGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022752960 7:33251451-33251473 ATGGCTGAGCATGAGGAGAGGGG + Intronic
1023398587 7:39774474-39774496 AGAAATGAGCATGGTGGGAATGG + Intergenic
1023540945 7:41265198-41265220 TGGAAGGAACATGAGTAGAAGGG - Intergenic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023996984 7:45165082-45165104 AGGATGGAGGAGGAGGAGAAGGG - Intronic
1024182647 7:46911494-46911516 AGGAATGAGCATGAAAAGAGGGG - Intergenic
1024651850 7:51410234-51410256 AGAAATGAGCATGGTGGGAATGG - Intergenic
1025134061 7:56396015-56396037 AGAAATGAGCATGGTGGGAATGG - Intergenic
1025185652 7:56856235-56856257 AGAAATGAGCATGATGGAAATGG - Intergenic
1025686277 7:63720715-63720737 AGAAATGAGCATGATGGAAATGG + Intergenic
1025909962 7:65820355-65820377 AGAAATGAGCATGCTGGGAATGG + Intergenic
1026905066 7:74058102-74058124 AAGAATGAGAAGGAGGAGGAGGG - Intronic
1026988205 7:74568166-74568188 AGGAAGGAGGATGGGGGGAATGG + Intronic
1027470601 7:78568933-78568955 AGGGAAGAGCATGTGCAGAACGG - Intronic
1028465733 7:91149320-91149342 AGGAAAGAGCATGAAGAAATAGG - Intronic
1029041356 7:97579936-97579958 AGAAATAGGCATGAGGAGAAAGG + Intergenic
1029049572 7:97670364-97670386 AGGAGGGAGCAGGAGGAGAGAGG + Intergenic
1030245114 7:107376633-107376655 AGCAATGAGATAGAGGAGAATGG - Intronic
1031812988 7:126395202-126395224 GGGAAAGAGTATGAGGAAAAGGG + Intergenic
1031971603 7:128068714-128068736 AGGGATGAGGAAGGGGAGAAGGG - Intronic
1032048925 7:128633937-128633959 AGAAATGAGCATGGTGGGAATGG + Intergenic
1032466819 7:132151352-132151374 AAGAAGGAGGAGGAGGAGAAAGG + Intronic
1032466861 7:132151510-132151532 AGAAAGGAGGAGGAGGAGAAAGG + Intronic
1032466865 7:132151526-132151548 AGAAAGGAGGAGGAGGAGAAAGG + Intronic
1032466869 7:132151542-132151564 AGAAAGGAGGAGGAGGAGAAAGG + Intronic
1032466873 7:132151558-132151580 AGAAAGGAGGAGGAGGAGAAAGG + Intronic
1032523617 7:132563412-132563434 AGGAAGGAGAAGGAGGAGGAGGG - Intronic
1032824194 7:135553400-135553422 ACGAAAGACCATGAGGAGAGAGG - Intergenic
1033433856 7:141314492-141314514 AGGAATGAGTATGTGGTGGAAGG - Intronic
1033443697 7:141402408-141402430 AGGAATGAGCAGCAGGGGGAGGG - Intronic
1034478441 7:151302276-151302298 AGCCATGAGCATGAGTAGAGAGG - Intergenic
1034629638 7:152521186-152521208 AGGAATAAGCAGGAGGAGCTTGG - Intergenic
1034935065 7:155193614-155193636 AGGGTTGAGGATGTGGAGAAGGG - Intergenic
1035242085 7:157538727-157538749 AGGACTGAGAATGGGGAGGAAGG + Intergenic
1036126605 8:6068653-6068675 AGGAATGAGGAGGAGAAGGAAGG - Intergenic
1036754312 8:11462197-11462219 AGGAATCAGGAGCAGGAGAAAGG + Intronic
1037292520 8:17366433-17366455 ATGAATCAGCATCAGCAGAATGG + Intronic
1037635104 8:20694554-20694576 AGGGGTGAGCAGGAGGAGAAAGG - Intergenic
1037829346 8:22178787-22178809 AGGAAGGAGTTTGAGGAGGAGGG - Intronic
1038020759 8:23550412-23550434 AGGAATGAGCAAGAGGAGGCTGG + Intronic
1038378434 8:27067599-27067621 ACTAATGAGGATGCGGAGAAAGG - Intergenic
1039258105 8:35741013-35741035 ATGAATGAGAGTGAGGAGGATGG - Intronic
1039317325 8:36387872-36387894 AAGAAGGAGGAGGAGGAGAAGGG - Intergenic
1039696756 8:39921034-39921056 AGGAATTAGCTAGAGGAAAAAGG + Intronic
1040065117 8:43139289-43139311 AGGAATGAGCCAGATGGGAAGGG + Intergenic
1040985386 8:53288403-53288425 AGGAATATGCAGAAGGAGAAAGG - Intergenic
1041182523 8:55263410-55263432 AGGGAAGAGAATGAGAAGAATGG - Intronic
1041250262 8:55927229-55927251 AGGAATAAACATGTGAAGAATGG - Intronic
1041291190 8:56310194-56310216 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291195 8:56310210-56310232 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291200 8:56310226-56310248 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291205 8:56310242-56310264 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291210 8:56310258-56310280 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291215 8:56310274-56310296 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291220 8:56310290-56310312 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291229 8:56310319-56310341 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1042144719 8:65715890-65715912 AGGCAGGAGAATGAGGAGAATGG + Intronic
1042702651 8:71633558-71633580 AGGAAAGAGAAAGAGGAGAGGGG - Intergenic
1042909961 8:73816536-73816558 GGGAATGAGGATGAAGAGGAAGG + Intronic
1042966806 8:74362357-74362379 AGGAATCAACAGAAGGAGAAAGG - Intronic
1043069564 8:75621232-75621254 ACATATGAGCATGAGGGGAAAGG + Intergenic
1043927045 8:86049196-86049218 AAGAATGAGAAGGAGTAGAAGGG + Intronic
1044493005 8:92842970-92842992 ATGAAGGAGCAAGAGAAGAAAGG - Intergenic
1045490864 8:102668103-102668125 AAGAATGACCAGGAGCAGAAAGG + Intergenic
1045757315 8:105559471-105559493 AAGAAAGAGTATGAGAAGAAGGG + Intronic
1045775695 8:105799943-105799965 AGGAAAGAGGATGAGCAGAAAGG - Intronic
1046021694 8:108672871-108672893 AAGAATGAGCAGGATGGGAATGG + Intronic
1047303993 8:123638515-123638537 AGCAATCAGGATAAGGAGAAGGG + Intergenic
1047637712 8:126782906-126782928 AGGAAAGACCATGCAGAGAAGGG - Intergenic
1048296914 8:133221178-133221200 AGGTATGAGCAAGAGGAGATGGG + Intronic
1048317304 8:133371680-133371702 AAGAATGAGGAAGAGCAGAAAGG + Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1049035526 8:140072570-140072592 AGGAAGGAGGAGGAGGAGAAGGG + Intronic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1051540221 9:18207220-18207242 AGGAATGAGAGAGAGGAAAAAGG + Intergenic
1051691905 9:19723171-19723193 AGGAATGTGCATGATAAAAATGG - Intronic
1051953655 9:22663589-22663611 AGCAAAGAGCAGGAGGACAAGGG + Intergenic
1053832152 9:42094725-42094747 AGGAAGGAGAAGGAGGAGGAAGG + Intronic
1054130776 9:61362147-61362169 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1054598393 9:67092699-67092721 AGGAAGGAGAAGGAGGAGGAAGG - Intergenic
1054695181 9:68353969-68353991 AGGTATAAGCATGAATAGAAAGG + Intronic
1054880757 9:70142316-70142338 AGGAATGGTGACGAGGAGAATGG + Intronic
1055086057 9:72315310-72315332 AGGAGCGACCATGAGGAGGATGG + Intergenic
1055453618 9:76453364-76453386 AGGGATGAGGATGATGGGAAGGG + Intronic
1055660601 9:78500116-78500138 TGGAATGACCATGTGGAGGAGGG + Intergenic
1055710616 9:79057348-79057370 ATGAAGGAGCATGAGGACATGGG + Intergenic
1055789756 9:79911405-79911427 AGGAATTATCATGAGGAAAGAGG + Intergenic
1055820133 9:80252558-80252580 AGGAGAGAGAGTGAGGAGAATGG + Intergenic
1056342694 9:85653229-85653251 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1056692506 9:88819879-88819901 AGGGATGGGCATAGGGAGAAAGG - Intergenic
1056912764 9:90718340-90718362 AGGAATGAGAATGACATGAATGG + Intergenic
1057280666 9:93708908-93708930 AGGAGTGAGGATGAAGAGCATGG - Intergenic
1057666258 9:97047772-97047794 GGAAGTGTGCATGAGGAGAAGGG - Intergenic
1057936602 9:99244887-99244909 AGGAAATAGAGTGAGGAGAAGGG + Intergenic
1058472731 9:105297833-105297855 AGGAAAGGGCATGAGCAGGAGGG - Intronic
1058561444 9:106233184-106233206 AGGAATGAGGAGGAGGAAGAAGG - Intergenic
1058793261 9:108472095-108472117 GGGAATGGGAATGAGGAGAAAGG - Intergenic
1059072451 9:111152917-111152939 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072463 9:111152959-111152981 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072476 9:111153001-111153023 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059520147 9:114933333-114933355 AGGAGAGAGAATGAGCAGAAGGG - Intergenic
1059823221 9:117997235-117997257 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1060348845 9:122839641-122839663 AGAAATGAGCATGATTAAAAGGG - Intergenic
1060623584 9:125090395-125090417 AGGAAGGAGGATGATGAGGAAGG + Intronic
1060657551 9:125382470-125382492 AGGCAGGAGAATCAGGAGAATGG - Intergenic
1061321068 9:129829906-129829928 AAGAAGGATCATGGGGAGAAGGG + Intronic
1061655926 9:132090060-132090082 AGAAATGAGGATGAGGTTAAGGG - Intergenic
1062061825 9:134501124-134501146 AGGGATGGGCACGAGGAGAGAGG - Intergenic
1062752527 9:138266161-138266183 AGAAATGAGCATGGTGGGAATGG + Intergenic
1203728830 Un_GL000216v2:72816-72838 AGGAATGGACACGAGTAGAATGG - Intergenic
1203343489 Un_KI270442v1:14825-14847 AGGAATGAAAATGAGCAGAGAGG + Intergenic
1203352819 Un_KI270442v1:95276-95298 AGGAATGAACACGAGTGGAATGG + Intergenic
1203575039 Un_KI270745v1:932-954 AGAAATGAGCATGGTGGGAATGG + Intergenic
1203656245 Un_KI270753v1:34-56 AGGAATGAGCAGGAGCAGAATGG - Intergenic
1203682223 Un_KI270756v1:74208-74230 TGGAATGAAAATGAAGAGAATGG - Intergenic
1185714464 X:2330133-2330155 AGGAAGGAGGAGGAGGAGAAAGG + Intronic
1186440102 X:9578523-9578545 AGAAAGGAGCACGAGGAGACGGG + Intronic
1187111004 X:16300300-16300322 TGGTATGAGGATGGGGAGAAGGG - Intergenic
1187410343 X:19045652-19045674 GGCAGTGAGCATGGGGAGAAGGG - Intronic
1187652353 X:21422416-21422438 AGGAAAGAGCATCAGGGGCAGGG - Intronic
1188207475 X:27378315-27378337 AGGCAGCAGAATGAGGAGAATGG + Intergenic
1188643635 X:32537262-32537284 AGGGATGAACATCAGGAGAGAGG + Intronic
1189033451 X:37472425-37472447 TGAAATGACCATGATGAGAAAGG + Intronic
1189694782 X:43653442-43653464 AACAATGAGAATAAGGAGAAAGG + Intergenic
1189701795 X:43720233-43720255 AGGAATGACCTACAGGAGAAGGG + Intronic
1190116063 X:47626957-47626979 AGGAAAGGGAGTGAGGAGAAAGG + Intronic
1191199537 X:57764363-57764385 AGAAATGAACATGAAGAGACAGG + Intergenic
1191598189 X:62971250-62971272 AGGAAAAAAAATGAGGAGAAGGG + Intergenic
1192022786 X:67411844-67411866 GGGGATGGGCATGGGGAGAATGG - Intergenic
1192106013 X:68317664-68317686 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1192271842 X:69588208-69588230 AGGAAGGATAATGAGCAGAATGG - Intergenic
1192561388 X:72130288-72130310 AGGAACAAGAATGAGGAGGAAGG - Exonic
1193224031 X:78960639-78960661 AGGAATGAATATGAGGATATAGG - Exonic
1193699143 X:84741925-84741947 AAGAATGAGTAGGAGGGGAAGGG - Intergenic
1195266525 X:103186140-103186162 AGGAATGAGCAGGAGTTGAGGGG - Intergenic
1195694769 X:107658797-107658819 AGGAAAGAGAAGGAAGAGAAAGG + Intergenic
1195756567 X:108204698-108204720 AGGAATCAGAACGAGGTGAATGG + Intronic
1195862470 X:109396538-109396560 AGAAATGAGCCTGAAGAGATAGG - Intronic
1195964095 X:110414409-110414431 AGGAAAAAGGATGAGGGGAAAGG + Intronic
1196063956 X:111442173-111442195 AGGAAGGAGAAAGAGGGGAAAGG + Intergenic
1196311446 X:114171418-114171440 AAGAAAGAGGAGGAGGAGAATGG - Intergenic
1196731094 X:118942243-118942265 AGGAAGGAGGAGGGGGAGAAGGG + Intergenic
1196868531 X:120090946-120090968 AGGAGAAAGCATGAAGAGAATGG + Intergenic
1197932779 X:131712495-131712517 AGCAAAGAGCAGGAGGACAAGGG - Intergenic
1198107714 X:133477154-133477176 AGGAATGAGCATGACCAGTGTGG + Intergenic
1198339400 X:135699484-135699506 AGGAATCTGAATGAGGAGGAAGG + Intergenic
1199517777 X:148697514-148697536 AGAAATGTGCCTGAGGAGATCGG - Intronic
1199543482 X:148983279-148983301 TGGAAAGAGAATGAAGAGAATGG + Intronic
1199895652 X:152125154-152125176 AAGAATGAACATAATGAGAATGG + Intergenic
1200368673 X:155697353-155697375 AGGACTGAGAACCAGGAGAAAGG - Intergenic
1200425879 Y:3019830-3019852 GGGAAAGAGCAAGAGGACAAAGG + Intergenic
1200751005 Y:6944055-6944077 AGTCTTGAGCATGAGGATAAAGG - Intronic
1201208467 Y:11655405-11655427 AGGAATGTACATGAGTGGAATGG + Intergenic
1201636458 Y:16128217-16128239 AGGAAAGAGAGTGAGGAGAGAGG - Intergenic
1201731086 Y:17203960-17203982 AGGGATGGGGAGGAGGAGAAAGG + Intergenic