ID: 1094682224

View in Genome Browser
Species Human (GRCh38)
Location 12:32677021-32677043
Sequence TGTGCACTACGCAACTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 1, 2: 13, 3: 64, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094682224_1094682225 -6 Left 1094682224 12:32677021-32677043 CCACTGGAGTTGCGTAGTGCACA 0: 1
1: 1
2: 13
3: 64
4: 175
Right 1094682225 12:32677038-32677060 TGCACAACTTCCACTACTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 99
1094682224_1094682226 -3 Left 1094682224 12:32677021-32677043 CCACTGGAGTTGCGTAGTGCACA 0: 1
1: 1
2: 13
3: 64
4: 175
Right 1094682226 12:32677041-32677063 ACAACTTCCACTACTGCTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 106
1094682224_1094682228 12 Left 1094682224 12:32677021-32677043 CCACTGGAGTTGCGTAGTGCACA 0: 1
1: 1
2: 13
3: 64
4: 175
Right 1094682228 12:32677056-32677078 GCTGGTGGTTCTTGTCCTCATGG 0: 1
1: 0
2: 2
3: 16
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094682224 Original CRISPR TGTGCACTACGCAACTCCAG TGG (reversed) Intergenic
900953311 1:5871730-5871752 TGCCCACTGAGCAACTCCAGAGG + Intronic
901154619 1:7127157-7127179 TGGGCACTATGCAACCCCAGGGG + Intronic
903240656 1:21980727-21980749 TGTGCACTGTGCAACTCTAGAGG - Intronic
903244399 1:22005350-22005372 TGTGCACTGTGCAACTCTAGAGG - Intronic
904962196 1:34342521-34342543 TGTGCTCTACACAACTCTAGGGG + Intergenic
905367814 1:37464621-37464643 TGTGAACTGCACAACTCCAGAGG + Intergenic
905750148 1:40455234-40455256 TCTGCACTACCAAACCCCAGAGG + Intronic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
907573322 1:55504095-55504117 TGTGCACTGCACAACTCTAGGGG - Intergenic
907791300 1:57667318-57667340 TGCACACTGCCCAACTCCAGTGG - Intronic
912989020 1:114465436-114465458 TGTGTACTACACAACTCATGGGG - Intronic
913290252 1:117265201-117265223 TGTGCACCACACAACCCTAGGGG + Intergenic
913671807 1:121104191-121104213 TGTGCACTGCACAATTTCAGGGG - Intergenic
913977096 1:143468700-143468722 TGTGGACTAGGGAACCCCAGTGG + Intergenic
914023585 1:143891636-143891658 TGTGCACTGCACAATTTCAGGGG - Intergenic
914071499 1:144294327-144294349 TGTGGACTAGGGAACCCCAGTGG + Intergenic
914107656 1:144672029-144672051 TGTGGACTAGGGAACCCCAGTGG - Intergenic
914662058 1:149799581-149799603 TGTGCACTGCACAATTTCAGGGG - Intronic
916942473 1:169690147-169690169 TGTGCACTGTACACCTCCAGGGG + Intronic
918809279 1:189094418-189094440 TCTGAGCTACCCAACTCCAGTGG + Intergenic
919844770 1:201634978-201635000 TCTGCATTGCCCAACTCCAGAGG + Intronic
923281998 1:232452376-232452398 TATGCACTCCACAACTTCAGAGG + Intronic
1065999518 10:31091370-31091392 TGTGCACTGCCCAACTTCAGGGG - Intergenic
1066264132 10:33758815-33758837 TGTGCACTGCGCAACTCCATGGG + Intergenic
1067285755 10:44906597-44906619 TGGGCATTACTCAACGCCAGTGG - Intergenic
1069109222 10:64424531-64424553 TGTGCACTACACAGCTCCATGGG + Intergenic
1069948965 10:72006533-72006555 TGTGTACTGCTCAACTCCAGGGG + Intronic
1069962219 10:72085918-72085940 TGGGCACTGCACAACTTCAGGGG + Intronic
1070568364 10:77620869-77620891 TGTGCACTGCACAACTCCAGAGG + Intronic
1070657848 10:78283436-78283458 TGTGCCTTACACAACTGCAGGGG - Intergenic
1070683767 10:78466957-78466979 AGTGCACTACCCAACTCCAGGGG - Intergenic
1070683775 10:78466994-78467016 TGTGCACTACCCAACTCCAGGGG - Intergenic
1071769109 10:88704462-88704484 TGTGAAATATGCAACTCTAGAGG + Intergenic
1072617318 10:97058546-97058568 TGTACACTGCACAACTTCAGGGG + Intronic
1074161631 10:110840875-110840897 TCTGCATTGCACAACTCCAGGGG - Intergenic
1074292751 10:112152500-112152522 TGTGCACGGCACAACTCGAGTGG + Exonic
1075444590 10:122504664-122504686 TGTGCACTAGGCCACACCAGGGG - Intronic
1078091449 11:8267044-8267066 TGTGCACTTCTTCACTCCAGCGG - Intronic
1079257725 11:18847010-18847032 TGTGCATTGCACAAATCCAGGGG - Intergenic
1079436551 11:20459298-20459320 TGTGTACTGCACAACTCCAGAGG + Intronic
1080294571 11:30711872-30711894 TGTTTACTACACAACTCCATAGG - Intergenic
1080403131 11:31955431-31955453 TATACACTACACAACTCCAGGGG - Intronic
1081539121 11:44017336-44017358 TGTGCACTGCACAACTCCAGGGG + Intergenic
1085279713 11:75321918-75321940 TCTGCACTACACAACTCCTTTGG + Intronic
1087016225 11:93556935-93556957 TGTAGACTAAGCTACTCCAGAGG + Intergenic
1087085576 11:94214915-94214937 TGTGTACTGCACAACTCTAGAGG - Intergenic
1087924551 11:103904235-103904257 TGTGCACTACAAATCTCTAGGGG - Intergenic
1090409020 11:126495038-126495060 TGTGCACTGGCCAATTCCAGTGG + Intronic
1091730247 12:2875462-2875484 TGTGCACTGAACAACTCTAGAGG + Intronic
1091805158 12:3350647-3350669 TGTGCACTGCACAATTCCAGGGG - Intergenic
1093563392 12:20571424-20571446 TGTGCGCTGCACAACTCCAGGGG - Intronic
1094484422 12:30913219-30913241 TGCACACTGCCCAACTCCAGGGG - Intergenic
1094682224 12:32677021-32677043 TGTGCACTACGCAACTCCAGTGG - Intergenic
1095623471 12:44285055-44285077 TGGGCACTGCAGAACTCCAGGGG + Intronic
1100393523 12:94164548-94164570 TGTGCCCTGCACAACTGCAGGGG - Intronic
1101994797 12:109517589-109517611 TGTGCACTATACAAGCCCAGGGG - Intronic
1102020447 12:109678644-109678666 TGTGCAGTGCACAACCCCAGGGG + Intergenic
1103127446 12:118436190-118436212 TGAGCACTATGTAACTCTAGGGG + Intergenic
1103707018 12:122880924-122880946 TGTGCACTGCCCAACTCCAGGGG + Intronic
1104914844 12:132259346-132259368 TGTGCACTGCACAACTACACCGG - Intronic
1105222130 13:18341116-18341138 TGTGGACTAGGGAACCCCAGTGG - Intergenic
1107252019 13:38375334-38375356 TGTGCGCTACCCACCTCCAGAGG + Intergenic
1108273790 13:48788098-48788120 TGGTCACTGCACAACTCCAGGGG + Intergenic
1108274126 13:48790729-48790751 TGGGCACTGCACAACTCCAGGGG + Intergenic
1112194209 13:97208800-97208822 TGTGTACTATACAACTCCAGCGG + Intergenic
1112201549 13:97281269-97281291 TGTCCACTGCACAACTCCAGGGG - Intronic
1112581590 13:100680717-100680739 TGTGCCCTGCCCAACTCCAGAGG - Intergenic
1115629836 14:35233365-35233387 TGTGCACTGAACAACTCTAGAGG - Intronic
1118366336 14:65100522-65100544 TCAGCACTACTGAACTCCAGTGG - Intronic
1119996968 14:79263807-79263829 TATGTACTACACAACTCCGGGGG + Intronic
1125766290 15:42138725-42138747 TGTGCACTGCACAACTTCAGGGG - Intergenic
1127581747 15:60345140-60345162 TGTGCACTGCACAACACCAAGGG + Intergenic
1128216933 15:65940902-65940924 TGTGCACTGCACAAATCTAGAGG + Intronic
1128250998 15:66164323-66164345 TGTGTACTGCACAACTCCATTGG - Intronic
1128562944 15:68680497-68680519 TGTACACTGCACAACTCAAGGGG - Intronic
1133324242 16:4933807-4933829 TGTGCACTGCACAATTCCATAGG - Intronic
1134634597 16:15782810-15782832 GGTGCACTGCACAACTCCGGGGG - Intronic
1134890157 16:17834381-17834403 TGCGCACTCCGCAAATCCAAAGG - Intergenic
1135249870 16:20891824-20891846 AGTACACTGCCCAACTCCAGAGG + Intronic
1135729385 16:24881758-24881780 TGTGCCCTATTCCACTCCAGGGG + Intronic
1137584453 16:49655921-49655943 GGTGCACGAGGTAACTCCAGTGG + Intronic
1137813564 16:51376260-51376282 TGTGCACTGCACAACTCCAGGGG + Intergenic
1142181177 16:88671360-88671382 TGTGCTCTCCACAACTGCAGGGG + Intergenic
1142489084 17:266358-266380 TGTGCTCCCCTCAACTCCAGTGG + Intronic
1143389786 17:6553510-6553532 TGTGCACTGCACAACTCCAGGGG + Intronic
1145188505 17:20817650-20817672 TGTGCACTGCACAACTCCAAGGG - Intergenic
1145900675 17:28488670-28488692 GCTGCATTACACAACTCCAGAGG - Intronic
1147796877 17:43050232-43050254 TTTGTGCTGCGCAACTCCAGAGG + Intronic
1149510244 17:57234986-57235008 GCTGCATTACACAACTCCAGGGG - Intergenic
1152652620 17:81502550-81502572 GGTGCACTGCACAACTGCAGGGG + Intergenic
1153581920 18:6582319-6582341 TGCACACTGGGCAACTCCAGGGG + Intronic
1156001321 18:32387939-32387961 TGTGCACTGCCCAACTCCAAGGG + Intronic
1156746260 18:40395147-40395169 TGTGCACTACGCAACTATGGTGG - Intergenic
1157399601 18:47376498-47376520 TGTGTACCACACAACTCTAGAGG - Intergenic
1157522585 18:48355620-48355642 ACTGCACTGCACAACTCCAGTGG + Intronic
1157622001 18:49021984-49022006 TGTGCACTGCTTAACTGCAGAGG + Intergenic
1158274926 18:55756851-55756873 TGTGCACTGCACAATTCCGGAGG - Intergenic
1162401937 19:10451740-10451762 GGTGCACTGCACAACTCCAGGGG + Intronic
1162468651 19:10858732-10858754 TGGGCACTGCACAACCCCAGGGG - Intronic
1163385973 19:17000803-17000825 TCTGCACTACTCTGCTCCAGAGG - Intronic
1165766056 19:38352011-38352033 TGTGCACTGCCCAACTCCAGGGG + Intronic
1168516316 19:57013034-57013056 TGTGCATTGCACAACTCCAGGGG + Intergenic
925014943 2:515922-515944 TGTGCCCTGCACCACTCCAGCGG - Intergenic
926119534 2:10234650-10234672 TGTTCCCCACCCAACTCCAGGGG - Intergenic
926945661 2:18185004-18185026 TGTGTACTGCACAACTCCAAGGG + Intronic
927513565 2:23659200-23659222 TGCACACTGCACAACTCCAGGGG - Intronic
928277280 2:29914437-29914459 TGTGCACTCTGCAACTCTAGGGG - Intronic
928298154 2:30103286-30103308 TGTGTACTACACAACTCCAGTGG - Intergenic
928435552 2:31252344-31252366 TGTGCACTGCACAACTACAAGGG - Intronic
929311721 2:40433572-40433594 TGTGCATTGCACATCTCCAGGGG - Intronic
930111011 2:47678520-47678542 TGTGCACTGAACAACTCCACAGG - Intergenic
930236884 2:48897178-48897200 TGTCCACTGCACAACTCTAGGGG + Intergenic
930593983 2:53363475-53363497 TGTACACCTCACAACTCCAGAGG + Intergenic
931686924 2:64801761-64801783 TGTGCACTGCACAACTCCAGAGG - Intergenic
931972910 2:67610068-67610090 TGTGGATTATGCAACTGCAGTGG - Intergenic
933383110 2:81576169-81576191 TGTGCACTGCACAACTCTAGGGG + Intergenic
934181797 2:89629678-89629700 TGTGGACTAGGGAACCCCAGTGG + Intergenic
934292102 2:91703897-91703919 TGTGGACTAGGGAACCCCAGTGG + Intergenic
934637782 2:96006856-96006878 TGTGCTCTGCACAGCTCCAGGGG + Intergenic
937095844 2:119234715-119234737 TGTGCACTGCACGCCTCCAGAGG + Intronic
938102826 2:128509354-128509376 TGTACACTGCACAACTCCAGGGG - Intergenic
938226170 2:129618444-129618466 TTTGTACTTCACAACTCCAGAGG + Intergenic
940326216 2:152427862-152427884 TGTGCACTGCACAAACCCAGGGG - Intronic
943122819 2:183758241-183758263 TGTGCACAGCACAACTCTAGGGG + Intergenic
945593102 2:211758763-211758785 TGTGCACTGCACACCTCCAAGGG - Intronic
946729411 2:222694010-222694032 TGTGCACTGAACAACTCCAGGGG + Intronic
946729418 2:222694072-222694094 TGTGCACTACTGAACTCTAGAGG - Intronic
946873977 2:224110201-224110223 TGTGCACTCTCCTACTCCAGAGG + Intergenic
948670240 2:239563882-239563904 TCTGCACTCCCCAATTCCAGGGG + Intergenic
1169183322 20:3590433-3590455 TGTGCACTGCAGAACTCTAGGGG - Intronic
1173529298 20:43756423-43756445 TGTGCACTAGGGCACTCCATGGG + Intergenic
1173532368 20:43780128-43780150 TGTGCACTGCACAAGTCCATAGG + Intergenic
1173849331 20:46208026-46208048 TCTGCATTGTGCAACTCCAGAGG - Intronic
1175200940 20:57277234-57277256 TGTGTACTGCACAACTCCAGAGG - Intergenic
1176730679 21:10493539-10493561 TGTGGACTAGGGAACCCCAGTGG - Intergenic
1178021223 21:28410819-28410841 TGTGCATTACTCAACTCAAAAGG + Intergenic
1178771460 21:35508619-35508641 TGTGCACTGCACAGCTCCAGGGG - Intronic
1183034751 22:35133132-35133154 CGTGCACTGCACAACTCTAGAGG + Intergenic
1183257979 22:36775476-36775498 AGGGCACTTCGCAGCTCCAGTGG - Intronic
949533029 3:4976319-4976341 TGTGCACCGCTCAACTCCAGGGG - Intergenic
950312500 3:11970747-11970769 TGTGCACTGCACAATTCCAGGGG - Intergenic
950454017 3:13082021-13082043 TGTGCACTACCCAACTCCATGGG + Intergenic
950524362 3:13515058-13515080 TGTGCACTGCACAACTCTCGAGG + Intergenic
951039608 3:17974782-17974804 TGTACACTGCACAACTCCAGGGG - Intronic
952573248 3:34742974-34742996 TTGGCACTATCCAACTCCAGAGG + Intergenic
955141452 3:56273899-56273921 TGGGCACTGCACAACTCTAGAGG - Intronic
955392858 3:58533938-58533960 TGTGCACTGCAAAACTCCAGAGG - Intronic
956073297 3:65477845-65477867 TGAGTACTGCACAACTCCAGGGG - Intronic
956180749 3:66516059-66516081 TGTTCACTGCACAACCCCAGGGG + Intergenic
956491959 3:69782108-69782130 TGTGCACTGCACAATGCCAGGGG - Intronic
956711207 3:72040239-72040261 TGTACACTGCACAACTCTAGGGG - Intergenic
956964766 3:74445903-74445925 TGTGCACTGCACAACTCAAGAGG + Intronic
961460046 3:127044392-127044414 TGTGCACTGCACAACTCCATGGG - Intergenic
963971292 3:151432072-151432094 TGCTCACCACACAACTCCAGAGG + Intronic
964384786 3:156136095-156136117 TGTGCACTGCACAACACTAGGGG + Intronic
964719670 3:159758685-159758707 TGTACACTGCACAACTCCAGAGG + Intronic
964850296 3:161088649-161088671 TGGGCACTACGCAACCCTTGAGG + Intronic
966221066 3:177551698-177551720 AGTGCACTTCCCACCTCCAGAGG + Intergenic
966420692 3:179731701-179731723 TGTGCACTACACAATTCCAAGGG - Intronic
967000126 3:185326233-185326255 TGTTTACTTTGCAACTCCAGGGG + Intronic
967689072 3:192452668-192452690 TGTGCACTGAACAACTCCAGAGG - Intronic
969004540 4:4008721-4008743 TGTGCATTACATACCTCCAGGGG + Intergenic
969748327 4:9091426-9091448 TGTGCATTGCACAACTCCAGGGG - Intergenic
969809359 4:9635986-9636008 TGTGCATTGCACAACTCCAGGGG - Intergenic
971779659 4:31016491-31016513 TGTGCATTGAGCAACTCCAGGGG + Intronic
971848436 4:31949929-31949951 TGGGCACTAGGCACCTGCAGTGG - Intergenic
973039193 4:45449674-45449696 TGTGCACAGCACAACTCTAGGGG - Intergenic
975592862 4:76017612-76017634 TGTGCACTCCCCAAGTCCACTGG + Intronic
976036730 4:80832212-80832234 TACGCACTACATAACTCCAGAGG + Intronic
977564004 4:98563050-98563072 TGTGCACTGCACAACTCCTGGGG + Intronic
980860458 4:138493577-138493599 TGTGCACTGCACAACTTTAGGGG - Intergenic
982160545 4:152564578-152564600 TATGCACTGCACAGCTCCAGGGG + Intergenic
989250426 5:39308009-39308031 TGTACAGTACACAACTCAAGGGG - Intronic
991232042 5:64345271-64345293 TGTGCACTGCGGAGCTCCAGAGG - Intronic
992210038 5:74469743-74469765 CATGCACTGCACAACTCCAGGGG + Intergenic
992956861 5:81918836-81918858 TGTGTACTGCGTAACTCTAGGGG - Intergenic
994496160 5:100516753-100516775 TGTGCACCCCGAGACTCCAGTGG + Intergenic
1000913078 5:167045706-167045728 TTTGCATTAAGCAACTCTAGGGG + Intergenic
1001192367 5:169643030-169643052 TTATCACCACGCAACTCCAGAGG + Intronic
1001498782 5:172211838-172211860 TGTGCAGAACCCAACACCAGTGG - Exonic
1001639708 5:173235874-173235896 TATGCACAGCACAACTCCAGGGG + Intergenic
1002585910 5:180247921-180247943 TGTCCACTACCAAACACCAGGGG + Intronic
1003148041 6:3525585-3525607 TGTTCACTGCACAACTCTAGGGG + Intergenic
1005250170 6:23936501-23936523 TGTGCAATGCACAACTCCAGAGG + Intergenic
1006786011 6:36667815-36667837 TGTGCACAGCACAACTCCACTGG + Intergenic
1008731851 6:54492164-54492186 TGTGCCCTCCCCAAGTCCAGTGG + Intergenic
1010554332 6:77260110-77260132 TATGCACTGCCCAACTGCAGAGG - Intergenic
1011579553 6:88844626-88844648 TGTGCACTGAATAACTCCAGAGG - Intronic
1012993021 6:105945726-105945748 TGTGCCCTCCTCACCTCCAGGGG - Intergenic
1013467345 6:110429406-110429428 TGTGTACAAGGCAACTCCAGGGG + Intronic
1014749113 6:125235271-125235293 TGTGCAATACGTAACTCCTGAGG + Intronic
1015219599 6:130789129-130789151 GTTGCACTACACAACTCCAGAGG + Intergenic
1015318135 6:131840718-131840740 TGTGCACAAAACAACTGCAGTGG - Intronic
1016705875 6:147107104-147107126 TTTGCACGAAGCAACTCCAGTGG + Intergenic
1017728820 6:157296356-157296378 TGTGCCCTGCACACCTCCAGGGG + Intronic
1018393891 6:163362307-163362329 TGTACCCTACCCCACTCCAGAGG + Intergenic
1018964606 6:168474683-168474705 TGTGCACTGCACAACTCCAGGGG + Intronic
1020324677 7:6965221-6965243 TGTGCATTACATACCTCCAGGGG + Intergenic
1020862253 7:13508804-13508826 TGTGCACTGCACAACCCTAGGGG - Intergenic
1021503564 7:21356185-21356207 TGGGCACTGCACAACTCCAAGGG - Intergenic
1021526888 7:21597903-21597925 TGTGTACTGCACAATTCCAGGGG + Intronic
1023413292 7:39909200-39909222 TGTGCACTCCCAGACTCCAGTGG + Intergenic
1023689755 7:42773526-42773548 TGTGCACTACACAACTTCTGGGG + Intergenic
1026568811 7:71511727-71511749 TGTGCACTGCCCAACTATAGGGG - Intronic
1027047669 7:75001864-75001886 TGTGCACTGCACAACTCTAAGGG + Intronic
1028885321 7:95926039-95926061 TGTGCATTAAGCAGCTCCAGAGG + Intronic
1029613042 7:101637509-101637531 TGTACACTGCCCAACTGCAGAGG - Intergenic
1030440566 7:109583841-109583863 TGTTCACTGGGCAGCTCCAGTGG + Intergenic
1032120167 7:129149770-129149792 TGTGGACTCCTCCACTCCAGGGG + Intronic
1032463817 7:132130940-132130962 TGAGCACTACGCATTTCCATCGG - Intronic
1032742893 7:134757289-134757311 TGTGCACTGCACAACTCCAGGGG - Intronic
1035106663 7:156446708-156446730 GGTGCACTACAGAACTGCAGGGG + Intergenic
1036167858 8:6454242-6454264 TGTGCATTTTGCATCTCCAGTGG + Intronic
1038989588 8:32853479-32853501 TGTGCACTGCACAATTCTAGGGG + Intergenic
1040023752 8:42763268-42763290 TATGCACCGCACAACTCCAGGGG - Intronic
1041566069 8:59280428-59280450 TGTGCCCTGCACAACTCTAGGGG - Intergenic
1043975996 8:86585455-86585477 TGTACACTGCACAACTCCAGAGG - Intronic
1044253892 8:90037401-90037423 TGAGCACTTCCCAAGTCCAGTGG + Intronic
1045362731 8:101448309-101448331 TGTGCACTGAGTAACTCCAGGGG - Intergenic
1045735328 8:105289603-105289625 TGAGCACTCAGCTACTCCAGAGG - Intronic
1047296099 8:123571795-123571817 TGTGCACTGCACAACTCAGGAGG + Intergenic
1047818893 8:128496423-128496445 TGTGTACTTCTCAACTCCAGGGG + Intergenic
1048195650 8:132329876-132329898 TGTGCACTGAACAACTCCAGGGG - Intronic
1048319050 8:133384391-133384413 TGTTCACTGCACAACCCCAGAGG + Intergenic
1048523760 8:135182100-135182122 TGTGCACTGCACAACTGCAGTGG + Intergenic
1048934803 8:139345945-139345967 TGTGTGCTAAGTAACTCCAGAGG - Intergenic
1050004779 9:1118771-1118793 TGTGCACTGCACAACTCCAAAGG + Intergenic
1050595201 9:7198011-7198033 TGTGCACTGCCCAATTCCTGGGG + Intergenic
1051203200 9:14653687-14653709 TTTGCACTGCACAACTCCACAGG + Intronic
1051499359 9:17760058-17760080 TGTGTACTGCACAACTCCAGGGG + Intronic
1052492031 9:29181987-29182009 TGTGTACTATGCAGCTCCAGGGG - Intergenic
1055192460 9:73542032-73542054 TGTGCTCTACACAGCTCCAGGGG - Intergenic
1058003275 9:99889295-99889317 GCAGCACTACACAACTCCAGGGG + Intergenic
1059016380 9:110520881-110520903 TGTGCACTCCACAACTTCAAGGG + Intronic
1059313518 9:113405036-113405058 TGAGCACTACTCAACTTCTGTGG - Intergenic
1059655813 9:116356362-116356384 TGTGCACTGCACAAGGCCAGTGG - Intronic
1060046950 9:120348997-120349019 TCTGCCCTATGCAACTCCAATGG - Intergenic
1060052772 9:120388924-120388946 TGAGTACTAAGCAAATCCAGGGG + Exonic
1061056481 9:128225451-128225473 CATGCACTGCACAACTCCAGGGG - Intronic
1061073305 9:128325369-128325391 TGGGCACTGCCCAATTCCAGGGG + Intronic
1061300429 9:129701571-129701593 TGTGCACTGTACAACTTCAGGGG - Intronic
1062367405 9:136217609-136217631 TGTGCTCTGGGCAACTCCTGAGG - Intronic
1185927458 X:4163046-4163068 TGTGCACTACACGACACTAGAGG + Intergenic
1186281086 X:7994076-7994098 TGTGCACTGCCCAATACCAGGGG - Intergenic
1187245830 X:17552167-17552189 TTTGCACTACACAAGTCCAAAGG + Intronic
1189770959 X:44426602-44426624 TGTGTACTGCACAACTCTAGGGG - Intergenic
1190490258 X:50975239-50975261 TGTACACTGCACAACTTCAGGGG + Intergenic
1191696391 X:63995001-63995023 TGTGCACTGGTCAACTTCAGGGG - Intergenic
1193671312 X:84389770-84389792 TGTGCACTGGGCAGCTCCGGTGG - Intronic
1195929084 X:110055396-110055418 TGTGCACTGCACAACCCTAGTGG - Intronic
1196601935 X:117611487-117611509 TGTGCACTGCACAACTCCACAGG + Intergenic
1198897373 X:141470531-141470553 TGTGCACTGTACAACTCTAGAGG + Intergenic
1199016237 X:142819525-142819547 TGTGCACTGGGCAGCTCCAGTGG + Intergenic
1201590321 Y:15607669-15607691 TATGTACTGCACAACTCCAGAGG + Intergenic