ID: 1094682932 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:32682049-32682071 |
| Sequence | AACTGAAGCCATTTAAGGTA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 169 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 16, 4: 150} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1094682932_1094682934 | -1 | Left | 1094682932 | 12:32682049-32682071 | CCATACCTTAAATGGCTTCAGTT | 0: 1 1: 0 2: 2 3: 16 4: 150 |
||
| Right | 1094682934 | 12:32682071-32682093 | TTCTATCTTGTTGAACTTTTTGG | 0: 1 1: 0 2: 0 3: 32 4: 470 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1094682932 | Original CRISPR | AACTGAAGCCATTTAAGGTA TGG (reversed) | Intronic | ||