ID: 1094682932

View in Genome Browser
Species Human (GRCh38)
Location 12:32682049-32682071
Sequence AACTGAAGCCATTTAAGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094682932_1094682934 -1 Left 1094682932 12:32682049-32682071 CCATACCTTAAATGGCTTCAGTT 0: 1
1: 0
2: 2
3: 16
4: 150
Right 1094682934 12:32682071-32682093 TTCTATCTTGTTGAACTTTTTGG 0: 1
1: 0
2: 0
3: 32
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094682932 Original CRISPR AACTGAAGCCATTTAAGGTA TGG (reversed) Intronic