ID: 1094685710

View in Genome Browser
Species Human (GRCh38)
Location 12:32712230-32712252
Sequence ACTTGGGCTTTTAGTGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094685710 Original CRISPR ACTTGGGCTTTTAGTGAAAT GGG (reversed) Intronic
901369401 1:8783728-8783750 ACTTTGGCTTAAATTGAAATGGG - Intronic
902667906 1:17952415-17952437 AGTTTGGCTTTTAGTGTAAGTGG + Intergenic
902991037 1:20187035-20187057 ATTTGGGTTGTGAGTGAAATAGG + Intronic
907097831 1:51797714-51797736 ACTAGGATTTTGAGTGAAATGGG - Intronic
907135156 1:52133472-52133494 ACTTGGGCTTTTAGGGAAATGGG + Intergenic
907726586 1:57025888-57025910 ATATGGGCTTTGAGTGAAAGAGG - Intronic
908954233 1:69601548-69601570 ACTTGTGCCTTTAGTGTTATAGG + Intronic
910323984 1:85982587-85982609 AGTTGGGATTTTAGTCAGATTGG - Intronic
911374390 1:97033582-97033604 ACTGGGGCTTATATTGAAATGGG + Intergenic
912325243 1:108751941-108751963 ACTTGGGATTTAAGTAGAATAGG + Intronic
919123398 1:193368539-193368561 ACTTGGCTATTTAGTGAAAGAGG + Intergenic
919359327 1:196570877-196570899 ACTTGATTTTTTAGTGGAATAGG - Intronic
1064096545 10:12428319-12428341 ACCTGGGCTTTTTGTGAATTAGG + Intronic
1066011609 10:31199547-31199569 CCTTGGGACTTTAGGGAAATTGG + Intergenic
1066134932 10:32435886-32435908 ACTTGGCCTTTTGGTGCAAGAGG + Intergenic
1066981178 10:42418100-42418122 CCCTGGGCCTTGAGTGAAATAGG - Intergenic
1067948473 10:50707534-50707556 TGTTGGGCTTTTAGTGCAACTGG - Intergenic
1068577013 10:58695430-58695452 AGTTGGTCTTTTAGAGAAACAGG + Intronic
1070511054 10:77160989-77161011 ACTGGGCCTTTTAGAAAAATAGG - Intronic
1070883793 10:79872529-79872551 TGTTGGGCTTTTAGTGCAACTGG - Intergenic
1071650351 10:87388839-87388861 TGTTGGGCTTTTAGTGCAACTGG - Intergenic
1071807795 10:89143080-89143102 ACTTGGGATTTTTGTCAAACAGG + Intergenic
1072363370 10:94683012-94683034 ACTTGGGGTTTTTGTGGATTGGG + Intergenic
1072383992 10:94905056-94905078 ACTTGGGGTTTTTGTGGATTGGG + Intergenic
1073715360 10:106100410-106100432 ACTTGGGAGTTGAGTCAAATAGG - Intergenic
1075081223 10:119385180-119385202 ACTTTGACTTTGGGTGAAATGGG + Intronic
1076099860 10:127767551-127767573 ACTTGAGCTTGTATTGAAGTTGG + Intergenic
1076253135 10:128998648-128998670 GATTGGTCTTTTAATGAAATGGG + Intergenic
1076486421 10:130821801-130821823 TCTTTGGCTTTTAGTGAGGTTGG - Intergenic
1077359033 11:2132445-2132467 CCTTGGACTTTGAGTCAAATTGG - Intronic
1078857214 11:15215918-15215940 ACTTCAGCTTTAAGTGAATTGGG + Intronic
1078957792 11:16221486-16221508 ACTTGTGCTTTTATTGGCATTGG + Intronic
1079568176 11:21908954-21908976 AAATGGGTTTTTAATGAAATGGG + Intergenic
1080310933 11:30891075-30891097 ACTTGGGAATGTAGAGAAATGGG - Intronic
1081099259 11:38982147-38982169 ACTTGGGGTTTCCGTGAAAGAGG - Intergenic
1082576538 11:54812487-54812509 ATTTGGGCTTATGGTGAAAAGGG - Intergenic
1082592489 11:55029990-55030012 ACTGAGGCTTATAGTGAAAAAGG - Intergenic
1087350727 11:97028750-97028772 ACTTGGGCTTTCAGGATAATAGG + Intergenic
1088584657 11:111352029-111352051 ACCAGGGCTTTTAATCAAATAGG + Intergenic
1089869285 11:121657672-121657694 ACTTGGCCTTGGAGGGAAATAGG + Intergenic
1090380076 11:126320401-126320423 ACATGGGCTTCTAGTGCAAAGGG + Intronic
1090651209 11:128807758-128807780 ACTTGTGCTTGTAGTAAAACAGG + Intronic
1093259418 12:16917390-16917412 CCTTGGTCCTTGAGTGAAATTGG - Intergenic
1093494837 12:19744439-19744461 AATTGAGCTTTTAATGAGATTGG + Intergenic
1093580312 12:20778650-20778672 ACTTTGGCTTTTAAAGGAATAGG + Intergenic
1094685710 12:32712230-32712252 ACTTGGGCTTTTAGTGAAATGGG - Intronic
1094858944 12:34437335-34437357 ACTGAGGCTTATAGTGAAAAAGG - Intergenic
1096102164 12:48976453-48976475 GCATGGGCTTTGAGTCAAATTGG + Intergenic
1098723852 12:73937367-73937389 ACTTGGGCTTTTACTAGTATTGG - Intergenic
1098739105 12:74148405-74148427 ACTTTGACTCTGAGTGAAATGGG - Intergenic
1099203359 12:79700840-79700862 ATTTGGATTTTAAGTGAAATAGG - Intergenic
1100665066 12:96742475-96742497 TCTCGGGCATTTAGGGAAATAGG - Exonic
1102940169 12:116933958-116933980 CCTTGGGATTTTAGTGAAATTGG + Intronic
1103322495 12:120100145-120100167 ACTTGGGCTGTTCCTGAACTGGG - Intronic
1103960695 12:124607381-124607403 AATTGGGGTTTTATTGGAATTGG - Intergenic
1104881039 12:132070347-132070369 AATTGGGCTTTTAAATAAATGGG - Intronic
1108031569 13:46236283-46236305 ATTTGTGCTTTTAATCAAATTGG - Intronic
1110656387 13:78005103-78005125 ACTTTGCTTTTTACTGAAATAGG - Intergenic
1110958703 13:81592315-81592337 ACTTGTGGTTTTACTTAAATTGG + Intergenic
1112175575 13:97020215-97020237 ACTTGTGCTTTACTTGAAATAGG - Intergenic
1114432289 14:22671691-22671713 CCCAGGGTTTTTAGTGAAATAGG + Intergenic
1114618898 14:24082939-24082961 ACTTGGGCTTTGAGGGAAGAGGG - Intronic
1114822781 14:26041646-26041668 ACCTTGGCTCTGAGTGAAATTGG + Intergenic
1116674322 14:47886265-47886287 ACTTGGCCTTTTAAATAAATTGG + Intergenic
1118528351 14:66671837-66671859 ATTTGTGCTTTCAGTGAACTTGG + Intronic
1121822045 14:96978380-96978402 CCTTGGGCTTGGAGTGAAAAGGG - Intergenic
1124124093 15:26921345-26921367 AATTGCGCTTTTTGAGAAATTGG + Intronic
1124685593 15:31779175-31779197 CCTTGGCCTTTTGGTTAAATAGG - Intronic
1124868065 15:33513626-33513648 ACTTGGGCTTGTAGTGAGGTGGG + Intronic
1127250284 15:57228104-57228126 ACTTGCTCTTTTTGTGGAATTGG + Intronic
1129141270 15:73600027-73600049 ACTTGGGGTTACAGTGGAATTGG - Intronic
1130928665 15:88404389-88404411 TCTTGGACTTTCAGTGAAAAAGG + Intergenic
1131749024 15:95485896-95485918 CCTTAGGCTTTTATAGAAATAGG - Intergenic
1134060747 16:11198172-11198194 TCTTGGGTTCTTTGTGAAATGGG - Intergenic
1135649012 16:24189141-24189163 ACTTGGGCTTTTAAGAAAAATGG - Intronic
1136363192 16:29794874-29794896 CCTTGGGCTTTTTGAGAATTTGG - Intronic
1136924027 16:34354708-34354730 ACATGGGTTTTTAATGAAAATGG - Intergenic
1136980546 16:35057098-35057120 ACATGGGTTTTTAATGAAAATGG + Intergenic
1137515866 16:49143599-49143621 ACTTGGTCGTTTATTGGAATGGG + Intergenic
1138276979 16:55742290-55742312 GCATGGGTTTTTACTGAAATGGG - Intergenic
1138282870 16:55785468-55785490 GCATGGGTTTTTACTGAAATTGG - Intergenic
1138939747 16:61775971-61775993 ACTTGGGCTTAGAGAGAAAGAGG - Intronic
1139556022 16:67710989-67711011 AATTGGGTTTTTAATGACATTGG - Intronic
1148039815 17:44697961-44697983 ACCAAGGCTTTTATTGAAATTGG + Intergenic
1148385272 17:47229861-47229883 ACCAGGGCTTTTAGGGAAAACGG + Intergenic
1150311743 17:64134570-64134592 ACTTTGGTTTTTAGGTAAATAGG + Intergenic
1153143979 18:2007875-2007897 ACTTGAGATTTTTGTTAAATAGG + Intergenic
1155063142 18:22246357-22246379 ACTTAAGATTTTAGTGAAATAGG + Intergenic
1156053757 18:32972041-32972063 ATTTTGGCTTTTTTTGAAATTGG + Intronic
1158292784 18:55960109-55960131 ACTTTTGATTTAAGTGAAATTGG - Intergenic
1159594084 18:70366012-70366034 ACTTGGCCTTTTAATAAATTGGG - Intergenic
1159855143 18:73578244-73578266 ACTTGCGTTTTCATTGAAATAGG - Intergenic
1160117800 18:76098212-76098234 ACTTGGGCTATTGGTTAAATTGG + Intergenic
1162894667 19:13758015-13758037 ACTTGGGCTTTTACTGAGGAAGG - Intronic
1166614424 19:44230381-44230403 ACAAGGACTTTGAGTGAAATGGG - Intronic
1167382578 19:49147204-49147226 ACTTGGGGGTTTAGTGACGTTGG + Intronic
1168473376 19:56659185-56659207 ACTTTGGCTTTACCTGAAATGGG - Intergenic
927130407 2:20053845-20053867 ATTTTGGCTTTTAGAGAAATCGG - Intergenic
930249271 2:49017417-49017439 AGTAGGCCTTTTAGTAAAATAGG + Intronic
930878621 2:56247510-56247532 ATTTAGGCTTTTAATGCAATAGG + Intronic
933097934 2:78211083-78211105 CCTTGGGCATTAAGTGAAATCGG + Intergenic
934608015 2:95712765-95712787 ACTGAGGCTTTTTCTGAAATTGG + Intergenic
937436669 2:121887236-121887258 ATTTGGGCTTTGAGTGGGATTGG - Intergenic
938120761 2:128631579-128631601 AGTTTGGGTTTTAGTGAAGTGGG - Intergenic
939011898 2:136856248-136856270 ACTTGGGCATTTAGAGAGTTGGG + Intronic
939057415 2:137381765-137381787 ACTTGGGCATTTTCTGGAATTGG - Intronic
940390779 2:153130308-153130330 ACTCTGACTTTGAGTGAAATGGG - Intergenic
944003611 2:194874498-194874520 ACTTGGGCGTTTGGTGCAAGAGG - Intergenic
944209406 2:197191210-197191232 ACTTGTGCTTTTGGTAAATTTGG - Intronic
944276610 2:197845993-197846015 ACTAGGAAATTTAGTGAAATGGG + Intronic
947156361 2:227165448-227165470 ACTTGGAATTTGAGTGAAACTGG + Intronic
1170614264 20:17936419-17936441 ACTGGGGCTTTGAGTCAAACAGG + Intergenic
1171474070 20:25394077-25394099 CCTTGGGTTTTGAGTGAGATGGG - Intergenic
1172203543 20:33145677-33145699 CCTTGGGCTTTAAGTGAACATGG - Intergenic
1172369203 20:34374659-34374681 ACTGGGACTTTAAGTGAACTAGG + Intronic
1175554810 20:59842703-59842725 ACTTCAGCTTTTGGTGAACTTGG - Intronic
1176848298 21:13893554-13893576 ACTTGGGCTTTTGGTATGATTGG - Intergenic
1179669154 21:42933463-42933485 ACCTTGGCTTTTAAAGAAATAGG - Intergenic
1181166115 22:20983928-20983950 ACTTGGGCTTTTACTCAGAGAGG - Intronic
1181386370 22:22548710-22548732 ACTTTGGGTTTTGGTGAAATGGG - Intronic
1184691034 22:46117333-46117355 ACAGTGGCATTTAGTGAAATGGG + Intergenic
949198956 3:1348179-1348201 ACTTGGGCCATTAGTTAACTTGG + Intronic
951379872 3:21969688-21969710 CCTTGGGCTTTAAGTGAACACGG + Intronic
952724310 3:36567214-36567236 GCTTGTGCTTTTAGAGGAATTGG + Intergenic
953479522 3:43238408-43238430 ATTTCTGCTTTTAGTGAAAAAGG - Intergenic
953745631 3:45571853-45571875 AGTTGGCCATTTATTGAAATGGG - Intronic
956389998 3:68761621-68761643 GCTTGGGCTTTTACTCAAAGTGG + Intronic
956435060 3:69226911-69226933 ACTTGTGCTTTGAGGGACATAGG - Intronic
956735203 3:72232844-72232866 ACTGTGCCTGTTAGTGAAATGGG + Intergenic
960989109 3:123299459-123299481 CCTTAGGCTTTGGGTGAAATTGG - Intronic
966585434 3:181618804-181618826 ACATATCCTTTTAGTGAAATTGG + Intergenic
966788103 3:183638367-183638389 CCTTTGGGTTTTAATGAAATGGG - Intronic
967219878 3:187239581-187239603 ACATGGTCTTTTAGCCAAATGGG + Intronic
968417292 4:451387-451409 ACTAGGGCATTTCGTGAACTGGG - Intronic
970364807 4:15347827-15347849 ACTTGGTCTTTTTATGAGATGGG - Intronic
971105240 4:23517438-23517460 CCTTGGGCTTTAAGTGAATATGG - Intergenic
973280384 4:48354388-48354410 ACTTAGCCTCTTAGAGAAATTGG + Intronic
973835139 4:54802124-54802146 AGGTGGGGTTTGAGTGAAATTGG - Intergenic
975836924 4:78432866-78432888 ACTTGGGCTTTTATGGCACTAGG - Intronic
975869058 4:78758034-78758056 ACTTAAGCTTTTACTGATATGGG + Intergenic
976749692 4:88441711-88441733 GCTTGGGCTTATAGAGAAATAGG - Intronic
977125419 4:93160496-93160518 AATTGTGTTTTCAGTGAAATTGG + Intronic
979900679 4:126213804-126213826 AATCTGGCTTTTTGTGAAATAGG + Intergenic
981048010 4:140283205-140283227 AATTTGGCCTTTAGTAAAATGGG - Intronic
982101532 4:151972862-151972884 ACATGGGCTTTTGGATAAATGGG + Intergenic
982105952 4:152012231-152012253 ACTTGACATTTAAGTGAAATGGG + Intergenic
982766698 4:159357013-159357035 ATTTGCGCTTTTAATGAATTGGG + Intronic
983091299 4:163505917-163505939 ACTTGGCCTTTTTCTGGAATAGG + Intronic
983174419 4:164571320-164571342 ATTTGACCTTTTAGTTAAATTGG - Intergenic
987131717 5:14866491-14866513 AATTTGGCTTTTAAGGAAATTGG + Intronic
988631797 5:32939545-32939567 ACTTGGAATTTTGGTGAAAGAGG - Intergenic
989688198 5:44112742-44112764 ACTCTGGCTTTTAGAGGAATAGG - Intergenic
991312387 5:65258464-65258486 ACTTTGGATTTAAGTAAAATGGG + Intronic
991440172 5:66638858-66638880 GCTTGGGTTTTTGGTGTAATTGG + Intronic
991714901 5:69442623-69442645 ACTTGGGCTTTTGGTTAAGTAGG - Intronic
993196535 5:84755138-84755160 ACTAGGGCTTTGAATGAAGTGGG + Intergenic
993950396 5:94167850-94167872 ACATAGGCTTTTCTTGAAATAGG + Intronic
995059306 5:107796248-107796270 CCTTTGGCTCTGAGTGAAATGGG + Intergenic
995315070 5:110760455-110760477 ACTTTGGCTTCTAGTCAGATGGG - Intronic
998059875 5:139111545-139111567 ACTTGGGCTTATAGTGATGGAGG - Intronic
999663358 5:153888532-153888554 ACTTGGGCTGTGAGTGAGATGGG + Intergenic
1001174605 5:169455558-169455580 ACTTGTGTTTTAAGTCAAATAGG + Intergenic
1001789337 5:174442236-174442258 ATTTTGGCTTTTGTTGAAATTGG - Intergenic
1001832745 5:174803260-174803282 ATTTGGGCCCTCAGTGAAATGGG - Intergenic
1008029637 6:46680031-46680053 ACTTCAGCTTTTAAGGAAATGGG - Intergenic
1008030154 6:46686667-46686689 GCTTTGGCTTTTAGAGAAATTGG + Intergenic
1009357497 6:62769679-62769701 ACTCTGGCTTGTGGTGAAATTGG - Intergenic
1010502806 6:76622465-76622487 ATTTGTGTTTTAAGTGAAATGGG - Intergenic
1011964314 6:93134789-93134811 ACTTGGGCTTTTAGGCAAAATGG - Intergenic
1014969197 6:127792930-127792952 TCTTGTGCTTTTAGCTAAATGGG + Intronic
1015656909 6:135529136-135529158 AGTAGGGCTTTTAATGAAAATGG - Intergenic
1017387417 6:153901863-153901885 GCTTGGGCTTTAAGTGAACATGG + Intergenic
1017538468 6:155374033-155374055 TTTTGATCTTTTAGTGAAATCGG + Intergenic
1018079821 6:160249078-160249100 AATTGGGCTCTTTGTGAAATGGG + Intronic
1023571813 7:41580224-41580246 ACTTGGGCTTCTAATAGAATAGG - Intergenic
1024323474 7:48090953-48090975 ACATGGGCTTTTTGTCAAAGTGG + Intronic
1024352795 7:48384288-48384310 ACAGGGGCTTTTCGTGTAATTGG + Intronic
1025521324 7:61733845-61733867 ATTTAGGCTTATAGTGAAAAAGG - Intergenic
1025521802 7:61743049-61743071 ATTTAGGCTTATAGTGAAAAAGG - Intergenic
1026791223 7:73333391-73333413 ACTGATGCTTTGAGTGAAATGGG - Intronic
1027829315 7:83157047-83157069 ACTTGGGCTTCTAGTGATCCAGG + Intronic
1030900028 7:115111938-115111960 AACTTGGCTATTAGTGAAATGGG - Intergenic
1034381155 7:150694048-150694070 TCTTGGGCTGTCAGTAAAATTGG + Intergenic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1040283373 8:46083819-46083841 ACTGAGGCTTCTAGTGAAAAAGG + Intergenic
1041354720 8:56988244-56988266 AATTGGGCTTTTAAGGAAGTTGG - Intronic
1042983858 8:74561844-74561866 ATTTTGGCTTTTATTGAACTTGG + Intergenic
1044860821 8:96521925-96521947 ACTTGGAATTTTAGTGAATTAGG - Intronic
1045477631 8:102566784-102566806 ACTTCTGCTTTTAGTGGGATGGG + Intergenic
1045486042 8:102632595-102632617 ACTTGTCCTTTGGGTGAAATTGG - Intergenic
1045914241 8:107447284-107447306 ACTTTGCCTTTGAGTGGAATGGG - Intronic
1047756590 8:127923657-127923679 ACTCTGGCTTTTGGTGAAAACGG + Intergenic
1047818285 8:128489269-128489291 ACCTTGGATTTTAGTGACATGGG + Intergenic
1048627355 8:136199931-136199953 CCTTGGGCTTTAAATGACATTGG - Intergenic
1048661409 8:136606820-136606842 ACTTTCACTTGTAGTGAAATAGG - Intergenic
1052558727 9:30055305-30055327 ACTTGGTCTTTTTGTAATATAGG - Intergenic
1054724912 9:68640535-68640557 ACTTGTGTTTTTGGTGAACTTGG + Intergenic
1056163921 9:83923785-83923807 ACTTGGCCCTATAGTCAAATTGG - Intergenic
1057644528 9:96860257-96860279 CCTGGGGCCTTGAGTGAAATAGG + Intronic
1058848681 9:108988580-108988602 ACTTTGGCTTTAAGTAAAATGGG - Intronic
1059263729 9:113006065-113006087 GCTTGAACTTTTAGAGAAATAGG - Intergenic
1187496796 X:19802511-19802533 ACTTGGACTTTTGGGGTAATTGG - Intronic
1188070715 X:25715121-25715143 ACCTGGGATTTTAGTGGAAAGGG - Intergenic
1192714088 X:73620721-73620743 ATTTTGGCTTTTGTTGAAATTGG + Intronic