ID: 1094687969

View in Genome Browser
Species Human (GRCh38)
Location 12:32737912-32737934
Sequence CAGCCTCAGCAGAAGCAGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 548}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094687969_1094687974 30 Left 1094687969 12:32737912-32737934 CCCCGCTGCTTCTGCTGAGGCTG 0: 1
1: 0
2: 4
3: 49
4: 548
Right 1094687974 12:32737965-32737987 AGCCTGCATGCCTTGTTCTCTGG 0: 1
1: 0
2: 0
3: 20
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094687969 Original CRISPR CAGCCTCAGCAGAAGCAGCG GGG (reversed) Exonic
900237557 1:1599986-1600008 CAGCAGCAGCAGCAGCGGCGGGG + Exonic
900354242 1:2252403-2252425 CAGCCTCCCCAGAAGCAGCTTGG + Intronic
900566814 1:3337384-3337406 CAGCCTCAGGAGCAGCAGTTGGG - Intronic
900961790 1:5927075-5927097 CTGCCTCAGCAGAAGCAGCTAGG + Intronic
901008268 1:6182183-6182205 CAGCCTCCCCAGTAGCAGCTGGG + Intronic
901104859 1:6747228-6747250 CAGCAGCAGGAGATGCAGCGGGG + Intergenic
901122615 1:6907729-6907751 CAGCCACTCCAGAAGTAGCGTGG + Intronic
901575287 1:10195880-10195902 CAGCCTCCCAAGAAGCAGCTGGG + Intergenic
901737542 1:11321998-11322020 CAGGCTCAGCAGAAGGATGGAGG - Intergenic
901875452 1:12164777-12164799 CGGCCTCAGCAGGAGAAGCCAGG + Intergenic
902082902 1:13833465-13833487 CTGGCTCAGCAGGTGCAGCGTGG - Intergenic
902954638 1:19917157-19917179 CAGCCGCAGAAGCAGCAGCAGGG - Intergenic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903537117 1:24074347-24074369 CAGGCTCACCAGAAGCAACCTGG - Intronic
903811110 1:26035536-26035558 CAGCCTCCGCAGAGGCTCCGCGG - Exonic
903918544 1:26782645-26782667 CAGGCAAAGCAGAAGCAGGGAGG - Intergenic
904696496 1:32334675-32334697 CAGCCTCAGAAGAAGAGGCAGGG - Exonic
904966322 1:34377316-34377338 CTGCCTCACCAGAAACAGCCAGG - Intergenic
905012128 1:34754962-34754984 GAGCCTCATCAGAAGCAGTCTGG + Intronic
905369710 1:37476565-37476587 CTGACTCAGCTGAAGCAGCCTGG + Intronic
905387112 1:37612792-37612814 CAGCAACAGCAGCAGCAGCAAGG - Exonic
905491443 1:38346994-38347016 CAGCCTCAGCCCCAGCAGCAAGG + Intergenic
906039975 1:42781236-42781258 CAGCCTCTGTGGAAGCAGGGAGG - Intronic
906387082 1:45379276-45379298 CTGCCTCAGCAGGAGTAGCTGGG + Intronic
906678951 1:47712025-47712047 CAGCATCAACAGAAGCAATGCGG + Intergenic
906950158 1:50328515-50328537 CAGACAGAGCAGAAGCAGCCTGG + Intergenic
906992725 1:50755863-50755885 CAGCCACAGCTGCAGCAGCTGGG + Intronic
907358716 1:53897533-53897555 CAGTCTCAGCTGCAGCAGCAGGG - Intronic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909379294 1:74979649-74979671 CATCTTCAGTAGAAGCAGCAAGG + Intergenic
910375056 1:86559329-86559351 CAACCTTAGGAGAAGCAGCTAGG - Intronic
912372831 1:109187043-109187065 CAGACTGAGCAGAACCAGTGCGG - Intronic
912447626 1:109750047-109750069 CAGGCCCAGAAGAAGCTGCGAGG + Intronic
912530602 1:110318369-110318391 CAGCCTCAGCTGACTCAGTGAGG - Intergenic
912543880 1:110437145-110437167 CCACCTCAGCAGGAGCAGCTGGG + Intergenic
912982353 1:114387013-114387035 TAACCTCAGCAAAAGCAGCTGGG + Intergenic
913321029 1:117588480-117588502 CAGCCTCTACAGACGCAGAGAGG + Intergenic
914455724 1:147834544-147834566 CACCGTCAGCAGAAGCAGTGTGG - Intergenic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
915249523 1:154578247-154578269 CAGCCACAGCAGCAGCTGCTGGG - Exonic
916318742 1:163479559-163479581 CAGCCACAGCTGTAGCAGCTAGG - Intergenic
917345210 1:174022257-174022279 CAGCCTCAGCAGCAGCAGGTGGG - Exonic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
920460750 1:206138157-206138179 AAGCCTCACCAGAAGCTGAGTGG - Intergenic
920600780 1:207321821-207321843 CAGCACCAGCAGCAGCAGCCGGG - Exonic
921000563 1:211039126-211039148 CAGCCACAGCTGGAGCAGCTGGG - Intronic
921431909 1:215075889-215075911 CAGCATCAGCAGAATAACCGGGG + Intronic
922115391 1:222608143-222608165 CAGCCACAGCTGAAGCAGGTGGG + Intergenic
922164076 1:223100514-223100536 CAGCCACAGCTGAAGCAGCTGGG - Intergenic
922464374 1:225836737-225836759 CAAACTCAGCAGAAGCAGAGAGG + Intronic
922969621 1:229725120-229725142 CAGCCGCAGCAGCAGCATCTGGG - Intergenic
923256583 1:232226640-232226662 CAGCAACAGCAGCAGCAGCCTGG + Intergenic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
924581715 1:245329564-245329586 CAGCCACTGCAGAAGCAGGACGG - Intronic
924624259 1:245686673-245686695 CATCATCAGCAGCATCAGCGAGG + Exonic
924925083 1:248671839-248671861 GAGCCTCAGCAGGACCAGTGGGG - Intergenic
1062798570 10:362489-362511 AAGCCTCGACAGAAGCAGCCAGG - Exonic
1063623057 10:7666872-7666894 CAGCCCCAGCAGCAGGAGCATGG + Exonic
1065159341 10:22903020-22903042 CAGTCTCAGCAGCAGCAGAATGG + Intergenic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1067024881 10:42836250-42836272 CAGCCTCAGAAGGAGCAGCGAGG - Intergenic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067724481 10:48759539-48759561 CAGCAACAGCAGCAGCAGCCAGG - Intronic
1067812325 10:49439397-49439419 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1068235464 10:54227402-54227424 CAGCCACAGCTGGAGCAGCTAGG + Intronic
1069292202 10:66793996-66794018 AAGCCTCAGCAGAAGGTGAGGGG - Intronic
1069367848 10:67712520-67712542 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
1070533665 10:77359455-77359477 CAGCCTCAGCCCAACCAGAGCGG + Intronic
1071018970 10:81029743-81029765 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1071807365 10:89138447-89138469 CAGCCTGAGCACAAGCACAGAGG + Intergenic
1072048141 10:91677657-91677679 CAGCCTCCTCAGGAGCAGCTGGG - Intergenic
1072665287 10:97388339-97388361 CAGCGTCAGCATGTGCAGCGTGG + Exonic
1073101827 10:101010530-101010552 CAGCCGCAGCCGCAGCAGCCGGG - Intronic
1073200683 10:101732726-101732748 GAGCCCAAGCAGAAGCAGCACGG - Intergenic
1073513437 10:104056997-104057019 CAGCCCCAGGAGTAGCAGCCAGG + Exonic
1074058186 10:109941710-109941732 CAGCCGTAGCAGAAGCACCTGGG + Intronic
1074944892 10:118271761-118271783 CTGCCTCAGCAGAAGCAGCAGGG - Intergenic
1075541807 10:123319816-123319838 CAGCCTCATGAGATGCAGAGTGG + Intergenic
1075721267 10:124588945-124588967 CAGCCACAGCCGGTGCAGCGCGG + Intronic
1076169599 10:128308304-128308326 CAGCTGCAGCTGGAGCAGCGGGG - Intergenic
1076406479 10:130215490-130215512 CAGCACCATCAGAAGCAGCCTGG + Intergenic
1076895882 10:133311718-133311740 CAGCCTCAGCAGAAGCCCCAGGG + Exonic
1077214120 11:1388290-1388312 CACTCACAGCAGCAGCAGCGGGG + Intergenic
1077259390 11:1607760-1607782 CAGCCTGAGGAGCAGCAGCAGGG + Exonic
1077259404 11:1607847-1607869 CAGCCTGAGGAGCAGCAGCAGGG + Exonic
1077259423 11:1607964-1607986 CAGCCTGAGGAGCAGCAGCAGGG + Exonic
1077261128 11:1621642-1621664 CAGCCTGAAGAGAAGCAGCAGGG + Exonic
1077262539 11:1630324-1630346 CAGCCTGAGGAGCAGCAGCAGGG - Exonic
1077444012 11:2581961-2581983 CAGCCTCTGCAGAAGCATCCTGG + Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078201649 11:9189110-9189132 CAGCCACAGCTGGAGCAGCTGGG - Intronic
1078467514 11:11561154-11561176 CAGCAGCAGCAGAAACTGCGAGG + Intronic
1079419151 11:20269981-20270003 CAGCCTCTCCAGAAGCCACGTGG + Intergenic
1079559445 11:21804003-21804025 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1080319932 11:30996355-30996377 CAGCCACATCAGAAACAGCTTGG + Intronic
1081812824 11:45922920-45922942 CAGCAGCAGCAGCAACAGCGCGG - Exonic
1082011510 11:47452864-47452886 CAGGCTCAACAGAGGCAGAGTGG + Intergenic
1082070398 11:47935017-47935039 CAGCCTCAAGAGTAGCAGCTGGG - Intergenic
1082617133 11:55374562-55374584 CTTCCTCAGAAGAAGCAACGTGG - Intergenic
1082625538 11:55479916-55479938 CTTCCTCAGAAGAAGCAACGTGG - Intergenic
1083121896 11:60521080-60521102 CAGCCACAGATGAAGCAGCTGGG + Intronic
1083235737 11:61349724-61349746 GCTCCTCAGCAGAAGCTGCGTGG + Exonic
1083668454 11:64287695-64287717 CAGCCACAGCACAGTCAGCGCGG - Intronic
1084086581 11:66857749-66857771 CAGCAGCAGCAGGAGCGGCGGGG - Exonic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1084798822 11:71527598-71527620 CAGCCTGAGGAGCAGCAGCAGGG - Exonic
1084803971 11:71566026-71566048 CAGCCTGAGGAGCAGCAGCAGGG - Exonic
1084806452 11:71582548-71582570 CAGCCTGAGGAGGAGCAGCAGGG + Exonic
1085716912 11:78880540-78880562 CAGCCTCAGCATAGTCAGTGTGG - Intronic
1085724715 11:78944220-78944242 CAACCTCTGCAGAAGCAGTTTGG + Intronic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1087795594 11:102452573-102452595 CAGCGTCCCCAGGAGCAGCGCGG + Exonic
1088325115 11:108593290-108593312 CAGCCTCCGCAGCAGCCGCTCGG + Intronic
1090109035 11:123884982-123885004 AAGTCTCAGCAGTAGCAGCAGGG - Intronic
1090189420 11:124758740-124758762 CAGCCTCTGCAGTTGTAGCGGGG + Intronic
1090387933 11:126367273-126367295 CAGCCTCAGGAGACGCTGCTGGG - Intronic
1090390572 11:126384719-126384741 CAGCCTCAGGAGATGCTGCTGGG - Intronic
1091187761 11:133661890-133661912 CTGCCACAGCAGAGGGAGCGGGG + Intergenic
1091214482 11:133892297-133892319 CAGCCACAGCAGAGGCGGAGAGG - Intergenic
1091241445 11:134055105-134055127 CAGCCTCAGCCGACCCTGCGGGG + Intergenic
1091255288 11:134178828-134178850 CAGCATCAGCAGACGAAGCCAGG + Exonic
1091705636 12:2691376-2691398 CCGCCTCTGCAGACGCAGCCGGG - Intronic
1092054812 12:5500039-5500061 CAGCCTAAACAGAAGGAGCCGGG + Intronic
1092075044 12:5665810-5665832 CAGCCTCAGCTGATCCAGCCAGG + Intronic
1092119382 12:6033538-6033560 CAGCCTCAGCAGCAAAAGAGAGG - Intronic
1092216178 12:6684733-6684755 CAGCCTCATCAGTAGCACAGTGG - Intronic
1092529404 12:9332072-9332094 CAGCCTCAGGAGAGGCAGTGAGG - Intergenic
1092695692 12:11169246-11169268 CACCCTCAGCAAAAGAAGTGTGG + Intronic
1093112389 12:15167388-15167410 CAGCATCAGCAGAATCACCTGGG + Intronic
1093287705 12:17285151-17285173 CAGCCTCAGGAGATGCATAGTGG + Intergenic
1093590464 12:20896021-20896043 CAGCCACAGCTGGAGCAGCTGGG + Intronic
1093997252 12:25655544-25655566 CAGCCTCAGCAGGTGAAGCTCGG - Intergenic
1094166252 12:27446870-27446892 CAGCATCAGCAAAAGCATCAGGG - Intergenic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1095818441 12:46450485-46450507 CAGCCTCTACAGAAGCAGTGGGG - Intergenic
1096180698 12:49548986-49549008 CAACTGCAGCAGCAGCAGCGAGG + Exonic
1097021413 12:56023169-56023191 CAGCCTCAGCCGAATAAGCTGGG + Intronic
1097196434 12:57244609-57244631 CACCCCCAGCACAAGCAGCCTGG - Exonic
1097523795 12:60704202-60704224 CTGCCTCAGCAGGAGTAGCTGGG + Intergenic
1098127515 12:67315336-67315358 CTGCCTCAGCTGTAGCAGCTAGG - Exonic
1101340317 12:103837211-103837233 CAGCCACAGCTGGAGCAGCTAGG + Intronic
1102471322 12:113161475-113161497 CAGCCGCAGCTGAAGCTGCTCGG + Intronic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1104355036 12:128077797-128077819 CAGATTCAGCAGAACCAGGGAGG + Intergenic
1105300956 13:19134156-19134178 CTGCCTCAGCAGGAGGAGCCTGG + Intergenic
1106134034 13:26961150-26961172 AAGGCTCAGCAGGAGCAGCTGGG - Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107017510 13:35719575-35719597 CAGGCTCAGCAGATGCCCCGGGG + Intergenic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107596573 13:41969223-41969245 CTGCCCCAGCTGAAGCAGCCAGG + Intergenic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1108057004 13:46495072-46495094 CTGCCCCAGCAGAAGTAGCAAGG - Intergenic
1108184348 13:47873465-47873487 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1108383006 13:49872199-49872221 CAGCCTCAGGAGCAGAAGCAGGG + Intergenic
1109274628 13:60290254-60290276 CAGCGTCAGCAGCAGCAACCAGG - Intergenic
1110209225 13:72953030-72953052 CAGCCTTGACAGAAGCAGCTGGG + Intronic
1111050880 13:82882402-82882424 TAGCCACAGCTGGAGCAGCGGGG - Intergenic
1112630485 13:101156395-101156417 CTCCCTCAGCAGAAAGAGCGGGG + Intronic
1112857809 13:103792482-103792504 CAGCCACAGCTGGAGCAGCTAGG + Intergenic
1113952956 13:114081887-114081909 CAGCCCCAGGAGATGCAGCCTGG - Intronic
1114365993 14:22027482-22027504 CAGCCTTGACAGAAGCAGCTGGG - Intergenic
1114664886 14:24371797-24371819 CTGCCTCAGCAGGAGTAGCTGGG + Intronic
1115496392 14:34008804-34008826 CAGCCTCACCAGAATCTGCTGGG + Intronic
1116138659 14:40959741-40959763 TAGCCACAGCTGAAGCAGCTGGG + Intergenic
1116318043 14:43422997-43423019 CAGCCTCAGCCCAAGTAGCTGGG - Intergenic
1116441785 14:44962438-44962460 GGGCGGCAGCAGAAGCAGCGCGG - Exonic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1116931367 14:50694382-50694404 CAGCCACAGCAGGAGCAGCTGGG + Intergenic
1118069588 14:62231723-62231745 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
1118149366 14:63173169-63173191 CAGCTTCAGAAGAAGCCGTGAGG + Intergenic
1119030430 14:71188106-71188128 CAGCCTCTGGAGAAGCTGCGGGG - Intergenic
1119200535 14:72748713-72748735 CAGCCACAGCTGGAGCAGCTGGG - Intronic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119869601 14:78004815-78004837 AAACCTCAGAAGAAGCAGTGGGG - Intergenic
1121121463 14:91378348-91378370 CAGCCTCAGCTAAACCAGCTTGG + Intronic
1121146987 14:91592963-91592985 CAGCCACAGCTGGAGCAGCTGGG - Intronic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121201586 14:92122239-92122261 CAGTCGCAGCCGAAGCGGCGGGG - Intronic
1121711050 14:96039452-96039474 CAGCGGCAGCGGCAGCAGCGAGG + Exonic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122356329 14:101125182-101125204 CAGCCTCAACATCAGCATCGGGG + Intergenic
1123425515 15:20167707-20167729 CAGCGTCCGAAGGAGCAGCGAGG - Intergenic
1123534737 15:21174225-21174247 CAGCGTCCGAAGGAGCAGCGAGG - Intergenic
1123761285 15:23434800-23434822 GAGCATCAGCAGAGGCAGCCTGG + Intergenic
1123774582 15:23566009-23566031 CAGCCTCAGGAGGAGGAGCCTGG + Exonic
1124268009 15:28254728-28254750 GAGCATCAGCAGAGGCAGCCTGG - Intronic
1124277222 15:28336194-28336216 GAGCATCAGCAGAGGCAGCCTGG + Intergenic
1124305479 15:28575412-28575434 GAGCATCAGCAGAGGCAGCCTGG - Intergenic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126317141 15:47382392-47382414 CTGCCTCAGCAGCAGTAGCTGGG - Intronic
1126377831 15:48013700-48013722 CAGCCTCAGCAGATGCTGACAGG - Intergenic
1126487389 15:49196966-49196988 CAGCCTCAGCAGAACTACAGAGG - Intronic
1126920196 15:53512883-53512905 CAGCCTCAGTAACAGCATCGTGG - Intergenic
1127401059 15:58586335-58586357 CAGTCTCAGCGGCAGCAGGGAGG - Intergenic
1128392685 15:67193328-67193350 CAGTCTCAGCACAAGCTGCAAGG - Exonic
1129414732 15:75368923-75368945 CAGCCTCAGAAGCAGCAACCGGG + Intergenic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1131188259 15:90293525-90293547 CAGAGTCTGCAGCAGCAGCGAGG + Intronic
1132712744 16:1276712-1276734 CAGCAGCAGCAGCAGCTGCGGGG + Intergenic
1132761324 16:1509881-1509903 GAGTCTCTGCAGAAGCAGCAGGG - Exonic
1132819927 16:1859907-1859929 GAGCCTCAGCAGGAGCCGGGAGG - Intronic
1133138458 16:3728397-3728419 CAGCAACAGCAGCAGCAGCAAGG - Exonic
1133303317 16:4795951-4795973 CAGCAGCAGCAGGAGCAGCACGG - Exonic
1133513494 16:6483625-6483647 AAGCCTCTGCAGAAGCTGCCTGG - Intronic
1133763516 16:8819182-8819204 CAGCCTCCTGAGGAGCAGCGGGG - Intronic
1134143590 16:11742685-11742707 CGGCGGCAGCAGCAGCAGCGAGG - Exonic
1134492712 16:14707693-14707715 CTCCCTCAGCAGAAGCGGTGAGG + Intergenic
1134498093 16:14746815-14746837 CTCCCTCAGCAGAAGCGGTGAGG + Intronic
1135313800 16:21426329-21426351 CTCCCTCAGCAGAAGCGGTGAGG - Intronic
1135366724 16:21858609-21858631 CTCCCTCAGCAGAAGCGGTGAGG - Intronic
1135404285 16:22186980-22187002 CAGCCTCAGCAAAAGCCCAGAGG - Intronic
1135445091 16:22512549-22512571 CTCCCTCAGCAGAAGCGGTGAGG + Intronic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1135879423 16:26239959-26239981 CACCCACAGCAGCAACAGCGTGG + Intergenic
1136193813 16:28637088-28637110 CTCCCTCAGCAGAAGCGGTGAGG + Intergenic
1136249240 16:28993059-28993081 CTACCTCAGCCCAAGCAGCGGGG + Intergenic
1136310464 16:29405032-29405054 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1136323912 16:29506820-29506842 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1136368351 16:29820335-29820357 CAGCTGCAGCAGAAGCAGCCCGG + Exonic
1136438597 16:30246803-30246825 CTCCCTCAGCAGAAGCGGTGAGG - Intronic
1136858733 16:33681815-33681837 CAGCATCAGAAGGAGCAGCAAGG + Intergenic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1138420987 16:56898941-56898963 CAGCCGAATCAGAATCAGCGTGG + Intronic
1139309646 16:66017786-66017808 CAGCTTCAGCAGAAGTAACGTGG + Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139476219 16:67203762-67203784 CAGCTCCAGCAGACGCAGCTTGG - Exonic
1139858148 16:69997418-69997440 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1140098576 16:71895497-71895519 CGGCCTCAGCACAACAAGCGCGG - Intronic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141180950 16:81753082-81753104 CATCCTCAGCAGAAGCTGGTGGG - Intronic
1141722636 16:85765309-85765331 CATCCTCAGCTGAGGCAGCCAGG - Intergenic
1141906328 16:87029165-87029187 GAGCCTCAGCAGAAGCTGGTGGG - Intergenic
1141915499 16:87093896-87093918 CAGCCGCAGCAGCCGCAGGGAGG + Intronic
1142154598 16:88527369-88527391 CACCCTCAGTAGCAGCAGCACGG - Intronic
1203120307 16_KI270728v1_random:1530308-1530330 CAGCATCAGAAGGAGCAGCAAGG + Intergenic
1142698843 17:1647775-1647797 CAGGCTCAGCAGAATGAGGGAGG + Intronic
1143271091 17:5675111-5675133 CGGCCTCAGAAGAAGGAACGTGG - Intergenic
1146501918 17:33372075-33372097 CAGCTTCAGGAGAGGCAGAGAGG - Intronic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147428179 17:40356187-40356209 CAGCTCCAACAGAAGCAGCCCGG + Exonic
1147468606 17:40634246-40634268 CAGCCTCAGCTGGAGTAGCTGGG + Intronic
1147613693 17:41816017-41816039 CAGCCTCCGAAGTAGCAGCTGGG - Intronic
1147971183 17:44219756-44219778 CAGCCTCAGCCGCCGGAGCGGGG + Intronic
1148216623 17:45836995-45837017 CTCCCTCAGCAGGAGCTGCGGGG - Intergenic
1148602408 17:48904384-48904406 CTGCCTCAGCAGGAGTAGCTGGG + Intergenic
1148640733 17:49185367-49185389 CAGCCTCAGCTGGAGCAGCTGGG - Intergenic
1150065608 17:62106403-62106425 CAGTCTCTGCAGAAGAAGCTAGG + Intergenic
1150803967 17:68304264-68304286 GAGCCTCAGCACAAGGAGGGTGG - Intronic
1151106081 17:71618656-71618678 CAGCCACAGCTGGAGCAGCTAGG - Intergenic
1151413700 17:73947836-73947858 GAGCCTGAGCTGGAGCAGCGAGG + Intergenic
1151756768 17:76079724-76079746 CAGCCTAAGCAGCAGCATGGAGG - Exonic
1152301193 17:79495922-79495944 CAGCCTGAGCAGTGGCAGCGTGG + Intronic
1152391213 17:80005196-80005218 CAGCCTCCGGAGTAGCAGCTTGG + Intronic
1152495593 17:80669120-80669142 CTGGCTCAGCAGGAGCAGCCAGG + Intronic
1152822230 17:82443267-82443289 CAGCTTCAGCATAAGCTGTGAGG - Exonic
1152891524 17:82884300-82884322 CATCCACAGCAGGAGCCGCGAGG + Intronic
1153010245 18:532172-532194 TTGGCACAGCAGAAGCAGCGTGG + Intergenic
1153484474 18:5582866-5582888 GAGCGTCAGCAGAGGCAGTGAGG + Intronic
1153539101 18:6135161-6135183 CAGCCACAGCTGGAGCAGCTGGG + Intronic
1154119594 18:11640690-11640712 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1156467549 18:37357283-37357305 CAGCCCCAGCTGGAGCAGCTAGG - Intronic
1157129283 18:44989103-44989125 AAGACTCAGCAGAAGCAACAAGG + Intronic
1158071423 18:53475468-53475490 CAGCCACAGCTGGAGCAGCTGGG - Intronic
1158311780 18:56166943-56166965 GAGCCTCAGCAGCAGCAGGCAGG + Intergenic
1159433332 18:68384213-68384235 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
1159866417 18:73711499-73711521 CAGCCTCAGAAAAAGCTGGGTGG + Intergenic
1159901685 18:74053098-74053120 GAGGGTGAGCAGAAGCAGCGTGG + Intergenic
1159987907 18:74866898-74866920 CAGCCTCAGCCGGAGTAGCTGGG - Intronic
1160590685 18:79943384-79943406 CAGCTTCAGCATCAGCAGCATGG + Exonic
1160866178 19:1257143-1257165 CAGCGACAGCAGTAGCAGCGGGG + Exonic
1161094420 19:2381313-2381335 CAGGGTCAGCAGAGGCAGCTGGG + Intergenic
1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG + Exonic
1161532386 19:4797817-4797839 CAGCCTCCCCAGTAGCAGCTGGG - Exonic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1163448768 19:17363280-17363302 CAGCCTCCCAAGAAGCAGCTGGG + Intronic
1163741624 19:19017472-19017494 CAGCCTCAGCTGCAGCACTGAGG - Intronic
1164649087 19:29879294-29879316 CAGCCTCAGCTCAAGGAGAGGGG - Intergenic
1164666482 19:30042267-30042289 CAGCCACAGCTGGAGCAGCTAGG - Intergenic
1166415037 19:42589172-42589194 CTGTCTCAGTAGAAACAGCGGGG - Intronic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1168097243 19:54122820-54122842 CAACCACAGCGGGAGCAGCGTGG - Intronic
925076072 2:1016867-1016889 CAGCCTCTGCAAAACCAGCCAGG + Intronic
925443121 2:3905518-3905540 TAACCTCAGCACAAGCAGCTGGG - Intergenic
926688145 2:15714365-15714387 CTCCCTCAGCAGAGGCAGCCTGG - Intronic
926764572 2:16313025-16313047 CAGCCTCAGCAGTAGAACAGGGG - Intergenic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
928048860 2:27968247-27968269 CAGCCACAGCTGAAGCAACTGGG - Intronic
928199873 2:29241010-29241032 CAGCCTCTGCAGAAGGGCCGTGG - Intronic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
929233518 2:39584047-39584069 CAGCCTCAGTAAAAGGAGCCTGG + Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
930018885 2:46989020-46989042 CAGCCTCATTAGAAGCTGCACGG + Intronic
930442983 2:51432252-51432274 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
931033530 2:58211331-58211353 CAGCCACAGCTGGAGCAGCTGGG + Intronic
931881394 2:66574868-66574890 CAGCCGCAGCAGCAGCAGCAGGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932821652 2:74906567-74906589 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
933980888 2:87549846-87549868 CAGCCTCAGCAGGAGAATGGGGG + Intergenic
934662092 2:96148495-96148517 AAGGCTCTGCAGCAGCAGCGAGG - Intergenic
936312942 2:111400939-111400961 CAGCCTCAGCAGGAGAATGGGGG - Intergenic
936827771 2:116602782-116602804 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
937022525 2:118671364-118671386 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
937992771 2:127673683-127673705 CAGCCCCAGCAGCAGCATTGAGG - Intronic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
939079152 2:137639211-137639233 CAGCCACAGCTGGAGCAGCTGGG - Intronic
939508329 2:143075982-143076004 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
939578068 2:143919516-143919538 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
940228145 2:151421945-151421967 CTGCCTCAGCAGGAGTAGCTGGG + Intronic
940236490 2:151516460-151516482 GAGTCTCAGCAGATGCAGAGTGG - Exonic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
942458429 2:176152978-176153000 CAGGCTGAGCCGAAGCTGCGGGG + Exonic
943571469 2:189580473-189580495 CAGCCGCAGAAGAGCCAGCGGGG - Exonic
944051802 2:195478498-195478520 CAACCTGAGCAGAAGCACCCAGG + Intergenic
944101381 2:196031248-196031270 CAGCCACAGCTGGAGCAGCTGGG + Intronic
944655538 2:201873520-201873542 CAGCTGCAGCAGCAGCAGCATGG - Intronic
944686993 2:202126254-202126276 CAGCCCCAAAAGAAGCAGCCAGG - Intronic
945986484 2:216358520-216358542 CAGCAGAAGTAGAAGCAGCGTGG + Intronic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947412760 2:229858931-229858953 CAGCCCCAGAAGAAGTAGCAGGG - Exonic
947736773 2:232459276-232459298 CAGCCTCAGCTGGCGCAGCGGGG + Exonic
947875349 2:233464173-233464195 CCGCCTCAGAAGGAGCAGCTGGG + Exonic
948199752 2:236121054-236121076 CTGCCTCAGCAGAAGCCCCAGGG - Intronic
948355247 2:237372557-237372579 GAGCCTCATCAGCACCAGCGAGG + Intronic
948433164 2:237933619-237933641 CTGCCTCAGCAGGAGTAGCTGGG + Intergenic
948635035 2:239329415-239329437 CAGCCTCTGCAGCAGCAGCTTGG + Intronic
948635174 2:239330046-239330068 CAGCCTCTGCAGCAGCAGCTTGG - Intronic
948657252 2:239484268-239484290 CAGCTCCTGCAGAAGAAGCGAGG + Intergenic
949043321 2:241859199-241859221 CAGCCTCAGGAGGGGCAGCTCGG - Intergenic
1169320837 20:4632036-4632058 TAGCCACAGCTGAAGCAGCTGGG - Intergenic
1170318781 20:15070704-15070726 CAGCCTCACCAGAAGCTGAATGG + Intronic
1172654795 20:36530076-36530098 CTGCCACAGCAGAAGCAGGAAGG - Intergenic
1173033910 20:39390374-39390396 CTGCCTAAGCAGAAGCAGATTGG - Intergenic
1173258487 20:41412304-41412326 CAGCCTCATCAGAAGAATCTGGG - Intronic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1174033174 20:47647337-47647359 CAGCTTCAGCAGAGGCTGCAGGG + Exonic
1174340278 20:49891063-49891085 CATCCTCAGCAGAAGTGGCCTGG - Exonic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175821904 20:61914546-61914568 CAGCCTCAGCAGAATAACCCTGG + Intronic
1176233146 20:64042121-64042143 CAGCCACAGCTGGAGCAGGGGGG - Intronic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1177266990 21:18798364-18798386 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
1178255753 21:31051005-31051027 CAGTCTCTGCAGAAGAAGCCAGG - Intergenic
1179959328 21:44759330-44759352 GAGCCTCAGCAGAAGGAGCCAGG - Intergenic
1180614872 22:17120598-17120620 CAGCCGCAGCAGCAGCAACACGG + Exonic
1180740853 22:18052400-18052422 CAGCAGCAGCAGAGGCACCGGGG + Intergenic
1181109185 22:20591411-20591433 GAGCCTCTGCTGAAGCAGGGAGG + Intergenic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181499029 22:23305409-23305431 CACCCTCAGCAGGGGCAGGGAGG - Intronic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1183668058 22:39256463-39256485 CAGCCTCAGCAGAGGCCCCGGGG + Intergenic
1183816016 22:40301186-40301208 CAGCAGCAGCAGAGGCAGCCAGG + Exonic
1184184773 22:42857247-42857269 CCGCCTCAGCAGGAGCGACGAGG + Exonic
1184208856 22:43023510-43023532 GAGGCTCAGCAGAAGAAGGGGGG - Intergenic
1184301546 22:43563659-43563681 CACCAGCAGCAGCAGCAGCGCGG - Intronic
1184380580 22:44142855-44142877 CTGCGTCAGCAGAAGCAGCAAGG - Intronic
1184381414 22:44147098-44147120 CAGTGTCAGCAGGAGCAGCTGGG + Intronic
1184460478 22:44635008-44635030 AAGCCTCTGCAGAAGGAGTGTGG - Intergenic
1184559685 22:45254878-45254900 CAGCGGCAGCAGAATCAGCAGGG - Intergenic
1184713277 22:46265695-46265717 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1184726149 22:46347805-46347827 CTGACCCAGCAGAAGCAGCAGGG - Intronic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1185277454 22:49955928-49955950 CAGCCTGAGCCGGAGCTGCGTGG - Intergenic
949917402 3:8975521-8975543 CTGCCTCAGTGCAAGCAGCGAGG - Intergenic
950364127 3:12471213-12471235 CAGCCTCAGCAGGAGCGATGTGG - Intergenic
950545202 3:13634243-13634265 CAGCCTCATCAGAGACAGCCAGG - Intronic
951317338 3:21203640-21203662 CAGTCTCAGTGGAAGCAGCATGG + Intergenic
952420027 3:33122289-33122311 CTGGTTCTGCAGAAGCAGCGGGG - Intronic
952644648 3:35640087-35640109 CAGCAGCAGCAGGGGCAGCGGGG + Intronic
953392980 3:42544638-42544660 CTGCCTCTGCAGAAGCAGCCTGG + Intergenic
953996092 3:47521180-47521202 CGGTCTCAGCAGAGGCAGCAGGG + Intergenic
954269356 3:49495539-49495561 CAGCCTCAGCAGAATCCAAGTGG - Intronic
954293856 3:49663487-49663509 CAGACACAGCAGCAGCAGCAAGG + Exonic
957759201 3:84533092-84533114 CAGCCACAGCAAGAGCAGCTAGG - Intergenic
958529594 3:95309532-95309554 CAGGCCCTGCAGAAGCAGCTAGG - Intergenic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959947139 3:112137117-112137139 CAGCCTGAGCAGACACAGCCTGG + Intergenic
959968381 3:112381423-112381445 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
960618271 3:119615696-119615718 CTGCCTCAGCAGGAGTAGCTGGG - Intronic
962630751 3:137273075-137273097 CAGCCTCAGCAGAATAAAAGTGG + Intergenic
963593020 3:147286658-147286680 CAGCCACAGCTGGAGCAGCTTGG + Intergenic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
966305131 3:178523165-178523187 CAGCATGAGCACAAGCAGAGAGG + Intronic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966886517 3:184380344-184380366 CAGCCCGAGGAGCAGCAGCGGGG - Exonic
967235858 3:187383079-187383101 TGGCCTCAGCTGAGGCAGCGGGG - Intergenic
967917641 3:194590649-194590671 CAGCCACACCAGAAGCACCCAGG + Intronic
968111831 3:196054607-196054629 CTGCCTCAGCAGAAGTAGCTGGG + Intronic
968193513 3:196688531-196688553 CAGCGTGGGCAGCAGCAGCGTGG - Intronic
968967850 4:3778339-3778361 CAGCTGCAGCAGCAGCAGCTGGG + Intergenic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970455526 4:16219996-16220018 CTGGCAGAGCAGAAGCAGCGAGG - Intronic
970868189 4:20782594-20782616 CAGCCACAGCTGGAGCAGCTGGG + Intronic
971282769 4:25255155-25255177 CAGCCTCGGCCAAAGCAGCAAGG - Exonic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
972872112 4:43313001-43313023 TAGCCACAGCTGAAGCAGCTGGG - Intergenic
973032215 4:45359320-45359342 CAGCCTCTGCAGCAGCAGCCTGG - Intergenic
973078626 4:45962185-45962207 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973624019 4:52752944-52752966 CACCCCCAGCACCAGCAGCGCGG + Intergenic
973766557 4:54168381-54168403 CAGCGTTAGCAGAGGCAGAGTGG - Intronic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
976051095 4:81012309-81012331 CAGCCACAGCTGGAGCAGCTAGG - Intergenic
976405627 4:84658258-84658280 CAGCCACAGCTGGAGCAGCTTGG + Intergenic
977320009 4:95501944-95501966 CAGCCACAGCAGAAGAAGAGAGG + Intronic
977463683 4:97357123-97357145 CAGCCACAGCTGGAGCAGCTGGG + Intronic
977666776 4:99652593-99652615 GAGCCTCCTCAGGAGCAGCGCGG - Exonic
979029151 4:115618379-115618401 CACCCTGAGTAGAAGCAGCACGG - Intergenic
979812508 4:125055356-125055378 CCCCATCAGCAGAAGCAGCTAGG + Intergenic
980335538 4:131468846-131468868 CAGCCACAGCTGAAGCAGCTTGG - Intergenic
980915965 4:139033557-139033579 CTGCCTCAGCCTAAGCAGCTGGG - Intronic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
982121275 4:152145741-152145763 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
983460729 4:168023044-168023066 CAGCCACAGCTGGAGCAGCTAGG + Intergenic
984365519 4:178794308-178794330 CAGCCCCTGCAGAAGCACCTGGG - Intergenic
984442531 4:179791454-179791476 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
985099215 4:186441698-186441720 CAGCATCAGCTGAAGAAGCCTGG + Intronic
985645654 5:1083596-1083618 CAGGCTCATCAGCAGCAGCTGGG + Intronic
985675085 5:1226787-1226809 GAGCCGCAGCACAGGCAGCGAGG - Intronic
985816195 5:2130075-2130097 CAGCCTCTGCAGGAGCCCCGGGG - Intergenic
985861622 5:2476024-2476046 AAAACTCAGCAGAAGCAGAGGGG + Intergenic
988620272 5:32816010-32816032 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
988808893 5:34765915-34765937 CAGCCACAGCTGGAGCAGCTGGG - Intronic
989341976 5:40386378-40386400 CAGCAACAGCAGCAGCAGCTGGG - Intergenic
989404740 5:41047712-41047734 CAGCCTTACCTGAAGCAGCATGG + Exonic
989598002 5:43175001-43175023 CAGCCTCAGCAGCATCTGCTTGG - Exonic
990329569 5:54712753-54712775 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
991073307 5:62510846-62510868 CTGCCTCAGCAGGAGTAGCTGGG + Intronic
991113571 5:62928513-62928535 CAGGCTCAGTAGAATCAGGGAGG + Intergenic
991340342 5:65601864-65601886 CAGCCACAGCTGGAGCAGCTGGG + Intronic
994542817 5:101121623-101121645 CAGCCCCAGCTGGAGCAGCTAGG + Intergenic
994850901 5:105053683-105053705 GAGGGTCAGCAGAAGCAGAGTGG - Intergenic
995392434 5:111653579-111653601 CAGCCATAGCTGAAGCAGCTGGG + Intergenic
996329395 5:122312180-122312202 CAGCCTCAGCCGAAGTAGGCGGG - Exonic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
997056688 5:130452255-130452277 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
997476199 5:134143983-134144005 CAGTCTCAGCAGAACTAGCCAGG - Intronic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998576683 5:143324420-143324442 CAGCCACAGCTGGAGCAGCTGGG + Intronic
998871525 5:146557345-146557367 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
998889328 5:146729638-146729660 CAGCCACAGCTGGAGCAGCTGGG - Intronic
999475273 5:151892416-151892438 CAGCCTCCTTAGAAGCAGCAAGG + Exonic
1000229637 5:159303448-159303470 AGGCCTCACCAGAAGCAGAGCGG - Intergenic
1002021192 5:176365477-176365499 CGGCCGCAGCAGTCGCAGCGGGG + Exonic
1002322070 5:178382224-178382246 CAGCCGCAGCAGCTGCAGCTGGG - Intronic
1002421274 5:179150299-179150321 GGCCCTCAGCAGAAGGAGCGGGG - Intronic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002709539 5:181186368-181186390 CAGCCTCATCTGAGGCAGGGGGG - Intergenic
1003508527 6:6759864-6759886 CAAGCTCTACAGAAGCAGCGCGG - Intergenic
1004202062 6:13558153-13558175 CATCCTCAGCAGAGACAGAGTGG + Intergenic
1005455688 6:26017687-26017709 CAGGAGCAGCAGAAGCGGCGGGG + Exonic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1006367579 6:33624613-33624635 CAGCCTCGGGAAAAGCAGAGGGG - Intronic
1006428950 6:33983400-33983422 GAGCCCCAGCAGCAGGAGCGAGG - Intergenic
1007517290 6:42422813-42422835 CAGCCTCAGCTCAAGCAGCCTGG + Intronic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1009316111 6:62223309-62223331 CAGCCACAGCTGGAGCAGCTAGG + Intronic
1010611848 6:77962961-77962983 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
1011883395 6:92059821-92059843 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013412343 6:109893192-109893214 CAGCTTCACCAGAAGCTACGGGG - Intergenic
1014010249 6:116467321-116467343 CAGCCCCAGCAGCAGCAGCCAGG + Intergenic
1014136587 6:117896564-117896586 AGGCCTCAGCAGAAGCTGAGCGG + Intergenic
1015969634 6:138730953-138730975 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1016568767 6:145489739-145489761 CAGCCTCAGCAGCATCTGCTTGG + Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018849652 6:167577893-167577915 CAGTCTCAGGAGAGGCACCGTGG + Intergenic
1019178638 6:170174164-170174186 CAGAAGCAGCAGAAGCAGCTAGG - Intergenic
1019328421 7:451018-451040 CAGACTCAGCAGAGGCAGGAAGG - Intergenic
1019361379 7:605911-605933 CAGCCCCAGCAGTCGCAGCCCGG + Intronic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019514041 7:1431999-1432021 CAGCCTCTGCAGGAGCCGGGCGG + Intronic
1019664346 7:2243951-2243973 TAGCCACAGCAGGAGCAGAGTGG + Intronic
1019877184 7:3824117-3824139 CACCCTCACCAGGAGCAGGGTGG - Intronic
1019883062 7:3880420-3880442 TAGCCTCAGCAGCAGGAGCCCGG + Intronic
1020049471 7:5072387-5072409 CAGCAGCAGCAGCAACAGCGGGG - Exonic
1020143227 7:5623745-5623767 CAGCCTCAGAAGGATCAGCTGGG + Intronic
1020397816 7:7736979-7737001 CAGCTTCTGGAGAAGCAGTGGGG - Intronic
1020423431 7:8036062-8036084 CAGCTACAGCAGAAGCAGATGGG - Intronic
1021568685 7:22041299-22041321 AAGCCACAGAAGAAGCAGCTCGG - Intergenic
1021601063 7:22363934-22363956 CATTCTCAGCAGAGGCAGCACGG - Intergenic
1023887815 7:44373692-44373714 CAGCCTCAGCTGTAGCAGGTAGG - Intergenic
1024672890 7:51612681-51612703 AAGCCTCTGCAGAATCAGTGTGG - Intergenic
1025704847 7:63853906-63853928 CTGCCTCAGCAGGAGTAGCTGGG - Intergenic
1026764986 7:73154820-73154842 CAGCAGCAGCAGCAGCACCGGGG + Intergenic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1027864956 7:83633689-83633711 CATCCTCAGCAAAAGCAGTATGG + Intronic
1028477190 7:91265154-91265176 CCGCCTCAGCAGCAACAGAGCGG + Exonic
1029051812 7:97697538-97697560 CAGCTTCAGCAAAGGCAGAGGGG - Intergenic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1029587764 7:101486404-101486426 CAGCCTCAGCAGAGACATTGAGG + Intronic
1029642423 7:101829559-101829581 AACCCTCAGCCGAAGCAGTGGGG + Intronic
1029727368 7:102415948-102415970 CAGCCTAAGCACATGCAGCGAGG - Intronic
1031966642 7:128031972-128031994 CGGCGGCAGCAGCAGCAGCGGGG + Intronic
1032179231 7:129661123-129661145 CAGCCACAGCTGGAGCAGCTGGG + Intronic
1032271013 7:130405924-130405946 CAGACACCGCAGAAGCAGAGAGG + Intronic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033665785 7:143439120-143439142 CATCCTCAGCAGCAGCATCTGGG - Intergenic
1034282669 7:149864781-149864803 CTCCCACAGCAGAAGCAGTGAGG + Exonic
1034440035 7:151081666-151081688 CAGCAACAGCAGGAGCAGCAGGG + Exonic
1034562383 7:151889459-151889481 CAGCCTCTGCAGAAGAAGTAGGG + Intergenic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1034946636 7:155266684-155266706 CAGTCACAGCAGAAGCTGGGAGG + Intergenic
1035127482 7:156619016-156619038 CGGCCTCCGCAGCAGCAGCTGGG + Intergenic
1038796060 8:30710602-30710624 CTGCCTCAGCACAAGTAGCTGGG - Intronic
1041008015 8:53514756-53514778 CAGCCTCAGCAGAGCCACAGTGG + Intergenic
1041167442 8:55103172-55103194 CAGCGGCAGCAACAGCAGCGGGG + Exonic
1041232546 8:55768395-55768417 CAGCTGCAGCAGCAGCAGCAAGG - Intronic
1041693290 8:60711369-60711391 CAGCCTCATCAGATACAGCTTGG + Intronic
1041746331 8:61212398-61212420 ATGCCTCAGCAGATGCAGCGGGG + Intronic
1041948148 8:63470147-63470169 CAGTCTCAGCAGAAAGAGAGAGG + Intergenic
1043485869 8:80698744-80698766 CAGCATCAGCAGAGGCAGCCCGG + Intronic
1045199581 8:99967069-99967091 GAGCATGAGCAGAAGCAGGGTGG + Intronic
1045293139 8:100850798-100850820 CAGCATCAGCAAAAGCTGCCTGG - Intergenic
1046054108 8:109058976-109058998 CAGCCCCAGCAGAGGCCGTGTGG - Intergenic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048346598 8:133580540-133580562 GAGGCTCTGCAGAAGCAGTGAGG - Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1049194584 8:141308338-141308360 CTGCGTCAGCGGAAGCGGCGCGG - Intergenic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1049602355 8:143513842-143513864 CAGCCTCAGCAAAGGCTGTGAGG - Intronic
1050340050 9:4627784-4627806 CAGCCTCAGCAAAAGAAAGGTGG + Intronic
1050929060 9:11301294-11301316 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1051902689 9:22059919-22059941 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1051946201 9:22572874-22572896 CAGCCACAGCTGCAGCAGCTGGG - Intergenic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1053279453 9:36808388-36808410 CAGCCCCAGCAGAACCAGATGGG - Intergenic
1053542847 9:38993161-38993183 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053807293 9:41816678-41816700 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1054447666 9:65385470-65385492 CAGCGGCAGCAGGAGCATCGCGG + Intergenic
1054623299 9:67370749-67370771 CAGCAGCAGCAGTGGCAGCGAGG - Intergenic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1056129241 9:83567242-83567264 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1056180198 9:84075622-84075644 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
1056831532 9:89921033-89921055 CAGCTTCAGCGGATGCAGCCTGG - Intergenic
1056924407 9:90820558-90820580 CAGCCACAGCTGGAGCAGCTGGG + Intronic
1057407256 9:94784164-94784186 TAGCCTCTGCACAAGCAGAGTGG + Intronic
1058174508 9:101722131-101722153 CAGCCACAGCTGGAGCAGCTGGG - Intronic
1058182436 9:101815365-101815387 GAGGGTGAGCAGAAGCAGCGTGG + Intergenic
1059587272 9:115619812-115619834 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1060045585 9:120337513-120337535 CAGGCACAGAGGAAGCAGCGTGG - Intergenic
1060290017 9:122293367-122293389 CAGCTTCAGCACAAGCTGTGTGG - Intronic
1060504119 9:124185525-124185547 CAGCCACAGCAGCAGCACCTGGG + Intergenic
1060770976 9:126332115-126332137 CAGCCTCAACAAAGGCACCGTGG - Intronic
1060933688 9:127504179-127504201 CAGCGTCCGCAGAAGCAGGCAGG + Intergenic
1061825742 9:133257184-133257206 CAGCCTCTGGAGAAGGAGCTGGG + Intronic
1062036834 9:134386220-134386242 CAGCCTCGGGTGATGCAGCGCGG - Intronic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062284930 9:135768634-135768656 CATCCTCAGCAGCAGGAACGAGG + Exonic
1062368243 9:136222368-136222390 CAGCCTGAGCAGAACCAGACAGG - Intronic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1062427128 9:136511212-136511234 CAGCCCCTGCAGAAACGGCGGGG - Exonic
1062525710 9:136977322-136977344 CTGCCCCAGCTGAGGCAGCGTGG - Intergenic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1186480613 X:9894216-9894238 CAGCCTCAGCAACATCACCGTGG + Intronic
1186748955 X:12601850-12601872 CAACTTCAGGAGAAGCAGCTTGG - Intronic
1186758728 X:12700935-12700957 CAGCCACAGCAGCTGCAGGGAGG - Intronic
1187940797 X:24379032-24379054 CAGCCTCAGCTGGAGTAGCTGGG + Intergenic
1188325549 X:28797083-28797105 CAGCCACAGCTGGAGCAGCTGGG + Intronic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1190032073 X:46983515-46983537 TAGCCTCAGCAAAAGTAGCTGGG + Intronic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1191188556 X:57640112-57640134 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
1191713133 X:64174156-64174178 CAGCATCAGCAGAAGCAAGTTGG - Intergenic
1192278932 X:69663334-69663356 TAGCCACAGCTGAAGCAGCTGGG - Intronic
1195210107 X:102646271-102646293 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1195838811 X:109149941-109149963 CAGCTTGAGCTGAAGCAGCTGGG - Intergenic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196169770 X:112574718-112574740 CAGCCACAGCTGGAGCAGCTGGG - Intergenic
1196603049 X:117623388-117623410 GAGGGTCAGCAGAAGCAGGGTGG - Intergenic
1197068795 X:122267738-122267760 CAACCCCAGCAGGAGCAGCATGG - Intergenic
1197547074 X:127838497-127838519 CAGCCACAGCTGGAGCAGCTGGG + Intergenic
1197706632 X:129639067-129639089 CGGCCTCAGCAGGACCTGCGAGG - Intergenic
1197987309 X:132279503-132279525 CCACCCCAGCAGCAGCAGCGTGG - Intergenic
1198275579 X:135095371-135095393 TAGCCACAGCAGAAGCCACGGGG + Intergenic
1199113300 X:143959576-143959598 CAGCCACAGCTGAAGCAGCTGGG + Intergenic
1199185500 X:144910793-144910815 CAGCTTGAGCTGAAGCAGCTGGG + Intergenic
1199600806 X:149540183-149540205 CAGCCACAGGAGAAGCAGGTCGG - Intergenic
1199649676 X:149939398-149939420 CAGCCACAGGAGAAACAGGGCGG + Intergenic
1199649728 X:149939558-149939580 CAGCCGCGGGAGAAGCAGGGGGG + Intergenic
1200122112 X:153796030-153796052 CATCCTCAGCAGAGACATCGGGG - Intronic
1201452233 Y:14129070-14129092 CAGCCACAGCTGGAGCAGCTAGG - Intergenic
1202335109 Y:23800819-23800841 CAGCATGAGCTGAAGCAGGGTGG + Intergenic
1202535658 Y:25869240-25869262 CAGCATGAGCTGAAGCAGGGTGG - Intergenic