ID: 1094687996

View in Genome Browser
Species Human (GRCh38)
Location 12:32738426-32738448
Sequence TCTTCCACAGGTTAGATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094687996_1094687999 15 Left 1094687996 12:32738426-32738448 CCTTTTATCTAACCTGTGGAAGA 0: 1
1: 1
2: 0
3: 14
4: 211
Right 1094687999 12:32738464-32738486 TTTTAATTAGTAACAATAATAGG 0: 1
1: 0
2: 2
3: 55
4: 550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094687996 Original CRISPR TCTTCCACAGGTTAGATAAA AGG (reversed) Intronic