ID: 1094687996

View in Genome Browser
Species Human (GRCh38)
Location 12:32738426-32738448
Sequence TCTTCCACAGGTTAGATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094687996_1094687999 15 Left 1094687996 12:32738426-32738448 CCTTTTATCTAACCTGTGGAAGA 0: 1
1: 1
2: 0
3: 14
4: 211
Right 1094687999 12:32738464-32738486 TTTTAATTAGTAACAATAATAGG 0: 1
1: 0
2: 2
3: 55
4: 550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094687996 Original CRISPR TCTTCCACAGGTTAGATAAA AGG (reversed) Intronic
900816810 1:4853661-4853683 TCTGCCATAGGTTAAAAAAAAGG - Intergenic
901619273 1:10569522-10569544 TCAACCACAGGATAGAGAAAAGG - Intronic
907325504 1:53636048-53636070 TCTTCCAGAGACTAGAAAAAGGG + Intronic
908257043 1:62311381-62311403 TCTGGCACAAGTTCGATAAAAGG + Intronic
909721973 1:78783123-78783145 TCTTCCAGAGAATAGAAAAAGGG + Intergenic
911579583 1:99619514-99619536 TCTTCCAAAAGTTAGGAAAAGGG + Intergenic
912227852 1:107755873-107755895 TTTTACACAGGTTAGAAGAAGGG + Intronic
912770672 1:112461807-112461829 CCTTCATCAGGTCAGATAAATGG + Intronic
913004274 1:114613102-114613124 ATATCCACAGGTTAAATAAAAGG + Intronic
913717791 1:121555397-121555419 TCTTCCACCTGTTATCTAAAGGG - Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
914968257 1:152281074-152281096 TATTCCACAAGATAGAGAAATGG + Intergenic
916479949 1:165206022-165206044 TGTTCCACAGCTCAGACAAACGG - Exonic
916783106 1:168057757-168057779 CCTTCCTCAGGTTAGATTAGGGG - Intronic
919047217 1:192468282-192468304 TGTTCCACATCTTAGAGAAAAGG + Intergenic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
921374974 1:214464378-214464400 TCTTCCCCAGCTGAAATAAAAGG + Intronic
921957175 1:220997122-220997144 TTTTCCACATGTTGTATAAATGG + Intergenic
1062765395 10:58997-59019 TCTTCCAGAGTTTAGAGGAAAGG + Intergenic
1063691944 10:8295882-8295904 TCTTCCCCAGGTAAGAAACAGGG - Intergenic
1063921328 10:10936214-10936236 TCTTGCAGAGGTTAGAAAGAAGG + Intergenic
1064907845 10:20367028-20367050 TATTCCACAAGATAGAGAAAGGG - Intergenic
1065338304 10:24677858-24677880 TGTTCCACAGAGTAGATACACGG + Intronic
1068781766 10:60926798-60926820 TCTTCCAGATCTTAGAAAAAAGG - Intronic
1073750486 10:106520726-106520748 TCTTCCATAAGTCAGTTAAATGG - Intergenic
1075387846 10:122070030-122070052 TTTTCCCCAGTTTAGATTAATGG + Intronic
1077980177 11:7292196-7292218 TGTTCCACAGGGTAGATGAGAGG + Intronic
1078890515 11:15552603-15552625 CTTTCCCCAGGTTTGATAAAAGG + Intergenic
1083005509 11:59341441-59341463 TATTCCACAAGATAGAGAAAGGG - Intergenic
1085719669 11:78902169-78902191 TCATCTACAGTTTAGAGAAAGGG + Intronic
1087333143 11:96809286-96809308 TGTTCCAGAGCTTAGAGAAATGG + Intergenic
1087720457 11:101659328-101659350 TGTTCCACATCTTAGAGAAAAGG + Intronic
1088992544 11:114966430-114966452 TCCTCAACAAGTTAGATAGAAGG - Intergenic
1091723225 12:2828035-2828057 CCAACCACAGGTTAGAGAAAAGG - Exonic
1094687996 12:32738426-32738448 TCTTCCACAGGTTAGATAAAAGG - Intronic
1094815732 12:34181625-34181647 TCTTCCAGATTTTAGAGAAAAGG + Intergenic
1096118960 12:49074202-49074224 TCATCCTAATGTTAGATAAATGG + Intergenic
1097563222 12:61234717-61234739 TGTTCCAGATCTTAGATAAAAGG + Intergenic
1098304569 12:69089810-69089832 TCTTCCACTGATTGGATAAGAGG + Intergenic
1101204625 12:102474179-102474201 TCTTCCACAGGATATTTTAAAGG + Intronic
1103372178 12:120427797-120427819 TCTTCCAAAGATTTCATAAAAGG - Intergenic
1110707615 13:78612762-78612784 TCTGCCACAGGTTAAATTTAGGG - Intergenic
1112199931 13:97264393-97264415 ACTGACACAGGTTTGATAAAAGG - Intronic
1113108814 13:106799859-106799881 GCTTCCACAGATAAGAGAAAAGG + Intergenic
1114241249 14:20870444-20870466 TCTTTCCCAGATTTGATAAATGG - Intergenic
1122064579 14:99163352-99163374 TCTTCCACCAGGTCGATAAATGG + Intergenic
1123840732 15:24244581-24244603 TCTTCCATAGGTTATCTAAAGGG - Intergenic
1123849792 15:24343106-24343128 TATTCCATAGGTTATCTAAAGGG - Intergenic
1123853687 15:24385084-24385106 TATTCCATAGGTTATCTAAAGGG - Intergenic
1123869656 15:24557701-24557723 TATTCCATAGGTTATCTAAAGGG - Intergenic
1124053993 15:26224856-26224878 TCTTCCAGAGGGTGGAGAAAGGG - Intergenic
1124585832 15:31005540-31005562 TCTTCCACAGCTTCAATGAAGGG - Intronic
1124606959 15:31176566-31176588 TATTCAGCAGGTTACATAAAAGG + Intergenic
1126216573 15:46162037-46162059 TCTTCCAGATCTTAGATGAAAGG - Intergenic
1126765159 15:52004275-52004297 GCTTCCAAAGGAAAGATAAAAGG - Intronic
1127814500 15:62595575-62595597 TCTTCGACATGTTGGATTAAGGG - Intronic
1132033693 15:98461081-98461103 TATTCCACAAGATAGAGAAAGGG + Intronic
1132469924 16:96827-96849 TCTCACAGAGGATAGATAAAGGG + Intronic
1133914607 16:10097727-10097749 TCTCCTACATGTTAGATGAAGGG - Intronic
1135910537 16:26556671-26556693 TCTTCCCCAGGTGAGATTAGAGG + Intergenic
1139089042 16:63621107-63621129 TCTTCCACAACTTTGATCAATGG - Intergenic
1141396787 16:83712117-83712139 TCTTAAACAGGTAAGTTAAAAGG - Intronic
1149157025 17:53643481-53643503 TATTCCAAATCTTAGATAAAAGG + Intergenic
1151011775 17:70506854-70506876 TCTTCCAAAGCATAGAAAAATGG + Intergenic
1152048102 17:77951879-77951901 CCTTCCACAGTTTAGATATGTGG + Intergenic
1153651338 18:7242957-7242979 TTTTCCAGATGCTAGATAAAGGG + Intergenic
1154478807 18:14796335-14796357 CCTTCCACAGGTAGGCTAAATGG - Exonic
1154478962 18:14797774-14797796 CCTTCCACAGGTAGGCTAAATGG - Exonic
1154479112 18:14799215-14799237 CCTTCCACAGGTAGGCTAAATGG - Exonic
1154479759 18:14808664-14808686 CCTTCCACAGGTAGGCTAAATGG - Intronic
1154498166 18:14977684-14977706 ACCTGCACAGGTCAGATAAAGGG - Intergenic
1156872116 18:41957251-41957273 ACTTCCAGAGGGTAGATCAAGGG + Intronic
1157265051 18:46211422-46211444 TGTTCCACTGGTTTGATAGAAGG + Intronic
1157983636 18:52411697-52411719 TCTTCCACATATTAGTCAAATGG + Intronic
1159973013 18:74676860-74676882 TTTTCCACAGTTTAGTAAAATGG + Intronic
1160572803 18:79830478-79830500 TATTCCTCAGCTTACATAAACGG + Intergenic
1160664675 19:319778-319800 TCCTCCAGAGGTTAGGAAAAAGG + Intronic
1161258132 19:3321008-3321030 TCTTCTCCAGGGCAGATAAATGG + Intergenic
1164473359 19:28554245-28554267 TGTTCAACAGGTTTGTTAAAAGG - Intergenic
1165613856 19:37181289-37181311 TTTTCCACATGTTGTATAAATGG - Intronic
1165893625 19:39129008-39129030 TGTTTCACAGTTCAGATAAATGG + Intronic
1202670145 1_KI270709v1_random:42339-42361 TCATCCTGAGGTTAGAGAAATGG - Intergenic
927329685 2:21847729-21847751 TATTCCTCTGGTTATATAAATGG - Intergenic
928798582 2:35057208-35057230 TATTCCACAAGATAGAGAAAGGG - Intergenic
929001903 2:37355241-37355263 TCTTCCACAGCTTAGAAGATAGG - Intronic
929283092 2:40104446-40104468 TCTTCCACTAATAAGATAAATGG - Intronic
930475747 2:51879319-51879341 TGTTCTACATGTTAGAGAAATGG - Intergenic
935192606 2:100791037-100791059 TCTGCCACAGGTTAGAACATGGG - Intergenic
936120567 2:109739792-109739814 TCTTCCAGATTTAAGATAAAAGG + Intergenic
936224128 2:110631655-110631677 TCTTCCAGATTTAAGATAAAAGG - Intergenic
937666814 2:124497179-124497201 TCTTCCACAAAATAGCTAAATGG + Intronic
938944658 2:136201025-136201047 TCTTCCAGAGCTTAGAGGAAAGG + Intergenic
939024800 2:136999314-136999336 TCTAGCAAAGGTTAGATAAAAGG - Intronic
939203967 2:139076066-139076088 GGATCCACAGGTTAAATAAAAGG + Intergenic
939885432 2:147676298-147676320 TTTTCCATAGGGTTGATAAATGG - Intergenic
940031544 2:149268161-149268183 TGTTCCAGATCTTAGATAAAAGG - Intergenic
941253614 2:163199321-163199343 TACTGCACAGGTTAGATAAATGG + Intergenic
941366253 2:164615099-164615121 GCTTCCACAGTTTAAATAAAGGG - Intronic
941937209 2:170993130-170993152 TCTTTCACTGGTTATATTAAAGG - Exonic
942977714 2:182038962-182038984 GCTTACACAGTTTAAATAAAAGG - Intronic
943794096 2:191970150-191970172 TCTTTAACAGGTTAAATAGAGGG - Intronic
944095688 2:195965036-195965058 TGTTCCAGATTTTAGATAAAAGG + Intronic
944549791 2:200835089-200835111 TCTTCCACTGTTTTGATGAATGG + Intergenic
945093739 2:206199903-206199925 TCTACCACTGGTTAGAGAATAGG - Intronic
945692947 2:213064666-213064688 TCATCGAAAGGTTGGATAAAGGG - Intronic
945844252 2:214925147-214925169 TGTTCCAGAGCTTAGAGAAAAGG + Intergenic
946042425 2:216793662-216793684 GCTTCCAGGGGTTAGAAAAAGGG + Intergenic
946779144 2:223175126-223175148 TTTTCCAGAGGTCAGATAAGAGG - Intronic
1171777588 20:29383639-29383661 TCTTCCAGATTTTAGATGAAAGG + Intergenic
1172347190 20:34210758-34210780 TGTTCCAGATGTTAGATGAAAGG + Intronic
1173032987 20:39379412-39379434 CTTTCCAGAGGTTAGATAAAGGG + Intergenic
1173199303 20:40942994-40943016 TCATCCACATGGTAGATAACGGG - Intergenic
1176337075 21:5609210-5609232 TCTTCCAGAAGTTAGGTACAGGG + Intergenic
1176390682 21:6211738-6211760 TCTTCCAGAAGTTAGGTACAGGG - Intergenic
1176470737 21:7104436-7104458 TCTTCCAGAAGTTAGGTACAGGG + Intergenic
1176494298 21:7486214-7486236 TCTTCCAGAAGTTAGGTACAGGG + Intergenic
1176506344 21:7652169-7652191 TCTTCCAGAAGTTAGGTACAGGG - Intergenic
1176800639 21:13426204-13426226 CCTTCCACAGGTAGGCTAAATGG + Intergenic
1176800780 21:13427638-13427660 CCTTCCACAGGTAGGCTAAATGG + Intergenic
1178260430 21:31094836-31094858 TCTTCCAGATCTTAGAGAAAAGG + Intergenic
1182931202 22:34175955-34175977 TCTTCCAGAGAGTAGGTAAATGG + Intergenic
1203324702 22_KI270738v1_random:2960-2982 TCATCCTGAGGTTAGAAAAATGG + Intergenic
949608090 3:5676163-5676185 TCCTCCATAGATTAGATAGAGGG + Intergenic
949626300 3:5870351-5870373 TCTTCAACAGGAAAGATAGAAGG - Intergenic
951293521 3:20903525-20903547 TTTTCCACAGGTTTGTTACAGGG - Intergenic
952367524 3:32688002-32688024 TCTTCATCAGGTAAGAAAAAAGG + Intronic
955148744 3:56345992-56346014 GCTTCCCCAGGTTAGTTAAGGGG - Intronic
955335182 3:58079591-58079613 TCTTCCACAGTTTCCATTAATGG - Intronic
957178292 3:76841507-76841529 TCTTCCACAGGAAAAATAAAAGG - Intronic
957249493 3:77755379-77755401 TCTTCCACAGGTTAGACAAAAGG - Intergenic
959722006 3:109502394-109502416 TATTCCACAAGATAGAGAAAGGG - Intergenic
959730918 3:109601236-109601258 TATTCCACAAGATAGAGAAAGGG - Intergenic
961228762 3:125280698-125280720 TCTTCCACATGTCTGATGAAAGG - Intronic
962637292 3:137344131-137344153 TCTTCAACATGTGAGATAAATGG - Intergenic
963490282 3:145991468-145991490 TGTTCCAAAGGTGACATAAAAGG - Intergenic
964031522 3:152144590-152144612 TCTTCCTCAGAGTATATAAAAGG + Intergenic
964582128 3:158251888-158251910 TCTTCCAGATGTTAGAGGAAAGG + Intronic
965156808 3:165070513-165070535 ATTTCTACAGGTTAGATAACTGG - Intronic
965860440 3:173142735-173142757 TTTTCCAAAGGTCAAATAAATGG + Intergenic
966564930 3:181367723-181367745 TCTTCCAGAGGCTACAGAAAGGG - Intergenic
966630903 3:182073875-182073897 TCTTCCAGATCTTAGAGAAAAGG + Intergenic
968018606 3:195362876-195362898 TCTTCCAGATCTTAGAGAAAAGG - Intronic
968270713 3:197401228-197401250 TTTTCCAAAGGCTAGAAAAAAGG - Intergenic
969748395 4:9091917-9091939 TCTTCAAGAGGTTAGAGAAGTGG + Intergenic
971132002 4:23821776-23821798 TCTTTCAGAGGTTAAGTAAATGG + Intronic
972409648 4:38780499-38780521 TCTTTCAGAGATTAAATAAATGG - Intronic
972437325 4:39045862-39045884 TCTTCCAGAGGTTAGATGTGCGG + Intronic
973222099 4:47738207-47738229 TCTGCCACAGGTGAGATATTTGG - Intronic
976200477 4:82573043-82573065 TCTTCAAAAGGTTAAATATAGGG - Intergenic
976280486 4:83322082-83322104 TCCTCCACAGGTCAGATGAGGGG + Intronic
976646166 4:87389785-87389807 TCTACCAAAGGTCAAATAAAAGG + Intronic
977020635 4:91754881-91754903 TCTTCCAGAGGTTTGATGTAGGG - Intergenic
977593246 4:98849847-98849869 TCTTCCAGAGAATAGATAAGAGG - Intergenic
977812495 4:101373504-101373526 TGTTCCAGAGGTTAGAGGAAAGG + Intergenic
979378599 4:119980336-119980358 TCTTCCACAGGTCAAATAATAGG - Intergenic
979646702 4:123077995-123078017 TCTTACACAGATTATATTAATGG + Intronic
979828713 4:125273708-125273730 TCTTCCACTTATTAGATGAAAGG + Intergenic
981453425 4:144926156-144926178 TGTTCCACATCTTAGAAAAAAGG + Intergenic
982012859 4:151123650-151123672 TCTTCATCAGGTTAGTCAAAGGG + Intronic
982264946 4:153529770-153529792 TCTCCCACAGGTTATGTGAAGGG - Intronic
982687902 4:158514074-158514096 TCTTCCAGAGTGTAGACAAAGGG + Intronic
983808201 4:172021201-172021223 TGTTCCAGATCTTAGATAAAAGG - Intronic
986558502 5:9036993-9037015 TATTCCAAATGTTAGATGAATGG - Exonic
987823459 5:22996050-22996072 TGTTCCAAAGCTTAGAGAAAAGG - Intergenic
989213311 5:38879100-38879122 TCTCCCACAATTTGGATAAAGGG + Intronic
989492090 5:42069343-42069365 TCTTCCAGATTTTAGATGAAAGG + Intergenic
989960775 5:50412510-50412532 TCTTCCACCTGTTACCTAAAGGG + Intronic
992742960 5:79792153-79792175 TTTTACACAGGTAAGATCAAAGG - Intronic
994005338 5:94830221-94830243 TCTTCCACAGGTAGGAGAAAGGG + Intronic
995772188 5:115683549-115683571 TCTCCAACAGATAAGATAAAAGG - Intergenic
996015535 5:118530068-118530090 TCTTCTACTGTTTAGATAAGTGG + Intergenic
1001039986 5:168327505-168327527 GCTTCTACAGTTTAGAGAAATGG + Intronic
1004305401 6:14497456-14497478 TCTGCCCAAGGTGAGATAAAAGG - Intergenic
1005356986 6:24994558-24994580 TCTTCTACAGGTGAGAATAAAGG - Intronic
1009329344 6:62396905-62396927 TGTTCCAGATGTTAGAAAAAAGG + Intergenic
1009922965 6:70085719-70085741 TTTTCAAGAGGTTAGATATATGG - Intronic
1010820378 6:80408438-80408460 TCTACCAGAGGTTAAAAAAAAGG - Intergenic
1010904043 6:81463914-81463936 TCTTTCAAAAGTTATATAAAAGG + Intergenic
1015043626 6:128752303-128752325 TGTTTCACAGGTTAGGTGAAAGG + Intergenic
1015362082 6:132351678-132351700 TATTCCACAAGATAGAGAAAGGG - Intronic
1015592891 6:134839338-134839360 TGTGCCACAGGTAAGAGAAATGG + Intergenic
1017396552 6:154006809-154006831 TGTTCCAGATCTTAGATAAAAGG - Intergenic
1020818076 7:12930884-12930906 ACTTACACAGTTTAGATAGAAGG + Intergenic
1022414838 7:30168975-30168997 TCTTCCACAGTTTAGAGGTATGG - Intergenic
1023259366 7:38342997-38343019 TCTTCAACACATTGGATAAAGGG + Intergenic
1023259823 7:38347323-38347345 TCTTCAACACATTGGATAAAGGG + Intergenic
1023260300 7:38351655-38351677 TCTTCAACACATTCGATAAAGGG + Intergenic
1023260812 7:38356486-38356508 TCTTCAACACATTGGATAAAGGG + Intergenic
1023261276 7:38360805-38360827 TCTTCAACACATTGGATAAAGGG + Intergenic
1023261792 7:38365611-38365633 TCTTCAACACATTGGATAAAGGG + Intergenic
1024362391 7:48481991-48482013 TCTTCCACTCACTAGATAAAAGG - Intronic
1024384395 7:48735033-48735055 TATTCCAGGGGTAAGATAAAGGG + Intergenic
1024746435 7:52411848-52411870 TCTTCCTCAGTTAAGATTAATGG - Intergenic
1026835956 7:73639225-73639247 TCATCCACAGATTAGGAAAATGG - Intergenic
1027413843 7:77952502-77952524 TCTTCCTCAGGATAATTAAAGGG - Intronic
1027880571 7:83829917-83829939 TTTTTGAAAGGTTAGATAAATGG + Intergenic
1028960380 7:96742247-96742269 TCTTCCCAAGGGTTGATAAAGGG + Intergenic
1029634228 7:101773212-101773234 TCATCCACAGGTGAGAAAACTGG + Intergenic
1030630327 7:111888508-111888530 TCTCCCACTGATTAGATAGATGG - Intronic
1031746239 7:125501897-125501919 TGTTCCACATCTTAGATGAAAGG + Intergenic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1035342400 7:158172217-158172239 ACTTCAAGAGGTTAGATAACTGG - Intronic
1038503533 8:28064622-28064644 ACTTCCACATGTTTGATCAAGGG + Exonic
1044915722 8:97111063-97111085 TGTTCCACAGGTAAGATCAATGG - Intronic
1047684881 8:127294997-127295019 TATTTCTCAGGTTATATAAATGG - Intergenic
1050939731 9:11443501-11443523 TCATCCACCAGTTAGAGAAAAGG - Intergenic
1051875591 9:21790177-21790199 TCTTCCTCAGGTTACTTATAAGG - Intergenic
1055369484 9:75581844-75581866 TCTACCAAAGGGTAGAAAAATGG - Intergenic
1055495907 9:76855387-76855409 TGTTCCAAAGGCTATATAAAAGG + Intronic
1056714678 9:89019326-89019348 TCTTCCCCAGCTTAGAGAAGAGG - Intronic
1058746961 9:108001110-108001132 TCTTCCATAAGAAAGATAAAGGG + Intergenic
1060701588 9:125756168-125756190 AATTCCACAGGTTGTATAAAGGG - Intronic
1062739854 9:138165260-138165282 TCTTCCAGAGTTTAGAGGAAAGG - Intergenic
1203424577 Un_GL000195v1:25696-25718 TCTTCCAGAAGTTAGGTACAGGG - Intergenic
1192680266 X:73246284-73246306 TGTTCCACAATTTAGAGAAAAGG - Intergenic
1194372015 X:93085555-93085577 TCTTCCAGATGTTATATAAAAGG + Intergenic
1194877216 X:99204005-99204027 TGTTCCAGAGTTTAGATGAAAGG + Intergenic
1195075076 X:101319157-101319179 TGTTCCACATCTTAGAGAAAAGG + Intergenic
1195880065 X:109584299-109584321 TCTTCCAGAGAATAGAAAAAGGG + Intergenic
1196217124 X:113066588-113066610 TCTTCCAAATGTTAGAGAAAAGG + Intergenic
1196764877 X:119234546-119234568 TTTTCTACAGGAAAGATAAAAGG - Intergenic
1196986499 X:121278979-121279001 TTTTCCAGATGTTAGAGAAAAGG - Intergenic
1197514855 X:127413783-127413805 TTTTCCAGATCTTAGATAAAAGG - Intergenic
1197535595 X:127685044-127685066 TCTTCCAGATCTTAGATAAAAGG + Intergenic
1198419639 X:136457544-136457566 TGTTGCACAAGTTAAATAAAGGG - Intergenic
1200680060 Y:6199592-6199614 TCTTCCAGATGTTATATAAGAGG + Intergenic
1201415963 Y:13749898-13749920 TCTTCCTCAGGTCAGATCAGTGG - Intergenic