ID: 1094687996 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:32738426-32738448 |
Sequence | TCTTCCACAGGTTAGATAAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 227 | |||
Summary | {0: 1, 1: 1, 2: 0, 3: 14, 4: 211} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1094687996_1094687999 | 15 | Left | 1094687996 | 12:32738426-32738448 | CCTTTTATCTAACCTGTGGAAGA | 0: 1 1: 1 2: 0 3: 14 4: 211 |
||
Right | 1094687999 | 12:32738464-32738486 | TTTTAATTAGTAACAATAATAGG | 0: 1 1: 0 2: 2 3: 55 4: 550 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1094687996 | Original CRISPR | TCTTCCACAGGTTAGATAAA AGG (reversed) | Intronic | ||