ID: 1094696825

View in Genome Browser
Species Human (GRCh38)
Location 12:32827958-32827980
Sequence CCCCTTGCCTTCAACCCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094696825_1094696831 5 Left 1094696825 12:32827958-32827980 CCTTAGGGGTTGAAGGCAAGGGG 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1094696831 12:32827986-32828008 GCCTTAGGAGAAGTAGAGTGAGG 0: 1
1: 0
2: 0
3: 19
4: 194
1094696825_1094696829 -10 Left 1094696825 12:32827958-32827980 CCTTAGGGGTTGAAGGCAAGGGG 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1094696829 12:32827971-32827993 AGGCAAGGGGCCAGGGCCTTAGG 0: 1
1: 0
2: 2
3: 48
4: 419
1094696825_1094696833 9 Left 1094696825 12:32827958-32827980 CCTTAGGGGTTGAAGGCAAGGGG 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG 0: 1
1: 0
2: 7
3: 45
4: 599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094696825 Original CRISPR CCCCTTGCCTTCAACCCCTA AGG (reversed) Intronic