ID: 1094696833 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:32827990-32828012 |
| Sequence | TAGGAGAAGTAGAGTGAGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 652 | |||
| Summary | {0: 1, 1: 0, 2: 7, 3: 45, 4: 599} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1094696825_1094696833 | 9 | Left | 1094696825 | 12:32827958-32827980 | CCTTAGGGGTTGAAGGCAAGGGG | 0: 1 1: 0 2: 0 3: 8 4: 163 |
||
| Right | 1094696833 | 12:32827990-32828012 | TAGGAGAAGTAGAGTGAGGAAGG | 0: 1 1: 0 2: 7 3: 45 4: 599 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1094696833 | Original CRISPR | TAGGAGAAGTAGAGTGAGGA AGG | Intronic | ||