ID: 1094696833

View in Genome Browser
Species Human (GRCh38)
Location 12:32827990-32828012
Sequence TAGGAGAAGTAGAGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 0, 2: 7, 3: 45, 4: 599}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094696825_1094696833 9 Left 1094696825 12:32827958-32827980 CCTTAGGGGTTGAAGGCAAGGGG 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG 0: 1
1: 0
2: 7
3: 45
4: 599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094696833 Original CRISPR TAGGAGAAGTAGAGTGAGGA AGG Intronic
900896713 1:5487706-5487728 TCGGAGAAGAGGAGTGAGGTGGG - Intergenic
901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG + Intronic
901354643 1:8634155-8634177 TAGTAGCAGCAGCGTGAGGATGG - Intronic
901469189 1:9443871-9443893 GAGGAGAAGGAGGGAGAGGAAGG - Intergenic
902185899 1:14725240-14725262 TAGATGAAGGTGAGTGAGGAGGG - Intronic
902517440 1:16996948-16996970 TGGGAGAGGTGGAGTGAGGCAGG - Intronic
902729067 1:18356917-18356939 TAGGGGATGGAGATTGAGGATGG + Intronic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903456702 1:23492428-23492450 GAGGAGAGGGAGAGTGAGAAGGG - Intergenic
903895262 1:26598825-26598847 TAGGAGAAGTTGAGCTGGGAAGG + Intergenic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904101880 1:28037047-28037069 TAAGAGAAGTAGCGAGAGAAAGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904730511 1:32587430-32587452 TAGGAAAGGTAGATTTAGGATGG + Intronic
904807272 1:33140861-33140883 AAGGAGAAGGGGAGAGAGGAGGG - Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
905913718 1:41671101-41671123 TAGGAGAGGCAGGGTGGGGAGGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906653712 1:47533150-47533172 TGGGGGAAGAAGAGGGAGGATGG - Intergenic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
907869157 1:58427216-58427238 GAGATGCAGTAGAGTGAGGAGGG + Intronic
908261085 1:62339610-62339632 TAGGAGACATAGGATGAGGATGG + Intergenic
909079867 1:71097197-71097219 GAAGAGATGTAGAGTGAGAATGG + Intergenic
909980944 1:82100186-82100208 TCTGTGGAGTAGAGTGAGGAAGG - Intergenic
910178562 1:84457227-84457249 GAAGAGAAGGAGAGTGAAGAAGG + Intergenic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910696843 1:90027592-90027614 TGGGAGAAGTAGAGGGAGTGGGG + Exonic
912208574 1:107534409-107534431 AAGGAGAAGTACAGTGTGTAGGG - Intergenic
912616326 1:111103333-111103355 TTGAAGAAGTGGAGTGAAGAAGG - Intergenic
912953312 1:114135472-114135494 TAGGAGGAGGAGATGGAGGAGGG + Intronic
913124476 1:115772428-115772450 AAGGAGAAGTATAGTGTGTAAGG - Intergenic
913380085 1:118201161-118201183 GAGGAGGAGGAGAGAGAGGAGGG - Intergenic
914829830 1:151162874-151162896 GAGTAGAAATAGAGCGAGGAAGG - Intronic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915109850 1:153556419-153556441 TTGGCTAAGTAGAGGGAGGAAGG + Intergenic
915358399 1:155270511-155270533 GAGGACAAGTAGAGTCAGGTGGG - Intronic
915536096 1:156536475-156536497 TAGGAGAAGGGGAGAGAGGATGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915805340 1:158842979-158843001 TAGGAGAACAAGACTGAGAAAGG + Intronic
916734609 1:167596859-167596881 TAGGAAGCGTAGAGAGAGGAAGG + Intergenic
917139388 1:171819829-171819851 AAAGAGAAGTTGAGTGAGGGTGG + Intergenic
917219401 1:172711608-172711630 TGGGGGAATGAGAGTGAGGATGG + Intergenic
917829654 1:178866929-178866951 TAGCAGAAGTAGAATGGGTAAGG + Intronic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
920674001 1:208026291-208026313 TATGAGAAGTGGGGTGAGGTGGG - Exonic
920955546 1:210617383-210617405 TTGATGAAGTAGAGAGAGGAAGG + Intronic
922072050 1:222204291-222204313 GAGGAGCAGTAGAGGGAGAAAGG + Intergenic
922213268 1:223501218-223501240 GAGGAGGAGGAGAGGGAGGAGGG - Intergenic
922564583 1:226593408-226593430 TGGGAGGAGAAGGGTGAGGATGG - Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
923037214 1:230292638-230292660 CAAGAGAAGGAGAGAGAGGAAGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923218270 1:231870098-231870120 TAAGAAAGGGAGAGTGAGGAAGG + Intronic
923295877 1:232594548-232594570 TCCCAGAAGGAGAGTGAGGATGG - Intergenic
924290353 1:242529852-242529874 AAGGAGAAAGAGAGAGAGGAAGG - Intergenic
924428402 1:243974768-243974790 TAGGAGAAGAGGAGTGGGCAGGG - Intergenic
924802150 1:247335385-247335407 TAGGAGGAGGAAAGTGAGGGAGG + Intergenic
924931268 1:248734254-248734276 TCTGAGAACAAGAGTGAGGAGGG - Intronic
1062784899 10:256203-256225 CTGGAGAAGTGGAGTGAGGCAGG - Intergenic
1062897144 10:1112380-1112402 TAGGAGAAGGTGAGAGACGAAGG - Intronic
1063392337 10:5658812-5658834 TAGGAGATTTACAGTGGGGAAGG + Intronic
1063726090 10:8638995-8639017 TAGGAAAAGTAGAGTTTGGCTGG + Intergenic
1064065840 10:12180861-12180883 TTGGTGAACTAGAGGGAGGAAGG - Intronic
1064130397 10:12704372-12704394 TAGGAGACATAGAGTGAAAATGG + Intronic
1065377463 10:25058155-25058177 GAGGACAAGTAGAGGGAGGAAGG - Intronic
1065905466 10:30247327-30247349 TAGGAGCAGTTGAAGGAGGAGGG - Intergenic
1066211511 10:33243899-33243921 AAGGAGAAGGAGAGTGGAGAAGG + Intronic
1066493077 10:35913647-35913669 TATGAGAAATAGACTAAGGAGGG + Intergenic
1067666483 10:48283852-48283874 TGGCTGAGGTAGAGTGAGGAAGG - Intergenic
1068931562 10:62595628-62595650 CAGGAGAAGTATTGTGAGTAGGG + Intronic
1069207526 10:65710443-65710465 AAGGAGAGGGAGAGTGATGAGGG + Intergenic
1069248013 10:66231861-66231883 GAGGAGGAGTAGAGAGAGAATGG - Intronic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1069361920 10:67652903-67652925 TAGGAAAAGTAAAGTTGGGAAGG - Intronic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070226105 10:74508160-74508182 TAGGAAAAGAAGAGTGATTAGGG + Intronic
1070339144 10:75480815-75480837 TTGGAGCAGTGGAGTGTGGAAGG + Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070815740 10:79321949-79321971 TGAGAGAAGCAGAGTAAGGAGGG - Intergenic
1071708137 10:88021679-88021701 TGTGAGGATTAGAGTGAGGAAGG + Intergenic
1072296441 10:94013299-94013321 TAGGAGGAGTGAAGTGAGGAGGG + Intronic
1072747091 10:97948366-97948388 GAGGAGAGCTAGACTGAGGAGGG + Intronic
1072792948 10:98332014-98332036 GAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1073029198 10:100511310-100511332 TAGGTGGAGTTAAGTGAGGAAGG + Intronic
1073081959 10:100865960-100865982 TGGGTGAAGAAGTGTGAGGAAGG + Intergenic
1073255619 10:102149154-102149176 TAGTAGGAGGAGAGTGAGGCAGG - Intronic
1073866498 10:107810371-107810393 TAAGAGAAGATGAGAGAGGAAGG - Intergenic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1074610501 10:115016813-115016835 GAGGAGAAGGAGAGTCTGGAGGG + Intergenic
1076241341 10:128910400-128910422 TGGGAGAAGTAGACAGGGGATGG - Intergenic
1076302750 10:129440434-129440456 TGGGTGAGGTAGAGGGAGGATGG - Intergenic
1077523294 11:3049052-3049074 GAGGAGAAGGAGGGTGAGCAGGG - Intronic
1077900266 11:6481909-6481931 TACGGGAAGTGGGGTGAGGAGGG - Intronic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078392078 11:10944009-10944031 CTAGAGAAGTAGAGTGAGGGTGG - Intergenic
1078885546 11:15496405-15496427 GTGGTGCAGTAGAGTGAGGAAGG - Intergenic
1079325995 11:19493167-19493189 TAGGAGGAGGAGAGAGGGGAGGG - Intronic
1080307970 11:30857227-30857249 TAAGAGAAGTATAGTGAAGTGGG + Intronic
1080412702 11:32040897-32040919 TAGAAAAAGGAGGGTGAGGAGGG - Intronic
1080524491 11:33100777-33100799 TAAGTGAAGTGGAGTAAGGATGG + Intronic
1081012694 11:37835005-37835027 GAGGAGTGCTAGAGTGAGGAAGG - Intergenic
1081567441 11:44268717-44268739 TGAGAGAGGGAGAGTGAGGAGGG + Intronic
1081894162 11:46570318-46570340 GAGGAGACTTAGAGTGGGGATGG - Intronic
1082677940 11:56131591-56131613 GAGTAGAAGAAGGGTGAGGAGGG + Intergenic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1085117241 11:73940493-73940515 TATGAAAAGTACAGTGGGGAGGG - Intergenic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087831462 11:102823655-102823677 TAGAAAAAGTAGAGTGAGGTTGG - Intergenic
1087834949 11:102863966-102863988 TAGGAGAGTTAGAATGAGCAGGG - Intronic
1088596027 11:111440881-111440903 GGGGACAAGGAGAGTGAGGAGGG + Intronic
1088753577 11:112866323-112866345 TAGGAGAAGTGGAAGGAAGAGGG - Intergenic
1089447366 11:118564224-118564246 AAGGAGAATAACAGTGAGGAAGG - Intronic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1090297194 11:125599125-125599147 TAGGAGAGGCAGAGTGAGAGAGG - Intronic
1090509780 11:127362968-127362990 GAATAGGAGTAGAGTGAGGAGGG - Intergenic
1090542368 11:127722392-127722414 CAGGAGGAGAAGAGTGAGGTGGG - Intergenic
1090613429 11:128492720-128492742 TTGGAGGTGTAGAGTGGGGATGG - Intronic
1090717216 11:129441138-129441160 TGGGACAAGTAGAATGAGAAAGG - Intronic
1091095955 11:132822244-132822266 TGGGAGAGGGAGAGTGAGGAGGG - Intronic
1091200051 11:133771595-133771617 TAGGAGAAAGAGAGTGAAGGGGG - Intergenic
1091407126 12:216002-216024 TAGGAAAACTTGAGTGAGGAAGG - Intergenic
1091407139 12:216097-216119 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407152 12:216192-216214 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407165 12:216287-216309 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407182 12:216382-216404 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407195 12:216477-216499 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407211 12:216572-216594 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091494872 12:963853-963875 CAGCAGAACTAGAGTGACGAGGG + Intronic
1091689604 12:2586807-2586829 CAGGAGGAGGGGAGTGAGGATGG - Intronic
1091696454 12:2631263-2631285 GAGGAGGAGGAGAGAGAGGAAGG - Intronic
1091947023 12:4555738-4555760 TAGAAGGAGGTGAGTGAGGATGG - Intronic
1092033720 12:5311965-5311987 TAGGAGAAAAAGAGTGTGAATGG - Intergenic
1092083854 12:5739677-5739699 CTGGAGAAGTAAAGTAAGGATGG + Intronic
1092233323 12:6790044-6790066 GAGGAGAAAAAGAGTGAAGAAGG + Intronic
1092564879 12:9654192-9654214 TAGGTGAAGCAAAGTGAAGATGG + Intergenic
1092905707 12:13098923-13098945 TAGAAGAGGTGGAGTGAGTAGGG - Intronic
1092906771 12:13107460-13107482 TATGAGAAGCTGAGGGAGGATGG + Intronic
1093092620 12:14938347-14938369 TAGGAGAAGGAAAGGGAGCATGG - Intronic
1094233649 12:28137939-28137961 TAGAAGAAGTGGGGTGAAGAAGG - Intronic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095587018 12:43860712-43860734 GAGGAGAAGTGGAGGGAGGTGGG + Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1097225513 12:57474974-57474996 CTGGGGAAGTAGAGTGAGGCGGG + Intronic
1097410679 12:59248721-59248743 TAGGAGGTGGGGAGTGAGGATGG + Intergenic
1097587912 12:61536949-61536971 TAGGAGAAGATGGGAGAGGACGG - Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1097668240 12:62506000-62506022 GTGGAGAAGTAGAGTTGGGATGG + Intronic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1098610358 12:72449892-72449914 TAGAAGGAGAAAAGTGAGGAAGG - Intronic
1098892038 12:76019056-76019078 GAGGAGAAGGAGAGAGAAGAGGG + Intergenic
1099149892 12:79097187-79097209 TAGAAGAGGTAGAGTGAAAAGGG + Intronic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1100162498 12:91876465-91876487 TAAGAGAAATAGAGAGAGGAAGG - Intergenic
1101057644 12:100935543-100935565 TAGGAGAAGAAGTCTAAGGAAGG + Intronic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101256513 12:102982876-102982898 TTAGAGAAGTGGAGTGGGGAAGG + Intergenic
1101597765 12:106182366-106182388 TAGGTAAGGTAGAGAGAGGAAGG + Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102378906 12:112446555-112446577 TAGCAGAAGAGGAGTAAGGAGGG + Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102761379 12:115388414-115388436 TAGGAGAAAGAGAGTAAAGAGGG - Intergenic
1102803232 12:115755932-115755954 AAAAACAAGTAGAGTGAGGAAGG - Intergenic
1102980533 12:117237473-117237495 TATGAGAAGTACAGGGAGAAGGG + Intronic
1103131840 12:118475735-118475757 TAGGGGAAGTAGAGGGAAGCTGG + Intergenic
1103219475 12:119231884-119231906 AAGGAGAAGGAGGGGGAGGAGGG - Intergenic
1103438117 12:120942622-120942644 TAAGAGAGGTAGGGTGAGGGTGG - Intergenic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1104148889 12:126062601-126062623 TAGGAAAAGTGGAGGGAGGGGGG - Intergenic
1104999867 12:132683285-132683307 CAGGAGAGCTAGAGTCAGGAAGG + Intronic
1105073613 12:133254218-133254240 TATGAGAACTGGAGTGAGGACGG + Intergenic
1105828464 13:24143319-24143341 TGGGAGAAGTAAAATGAGAAAGG - Intronic
1106466107 13:30015940-30015962 TAGGAGCACTAGAGTGTGGGTGG - Intergenic
1108116590 13:47135605-47135627 TAGGAGAACAAGAGTGAAGGTGG - Intergenic
1108195796 13:47993623-47993645 CAGGAGAAGTTGAGTTAGCATGG - Intronic
1108717062 13:53091566-53091588 GAGGAGAAGCAAAGTGGGGAGGG + Intergenic
1108730139 13:53226584-53226606 TAGGTGTAGAAGAGAGAGGAAGG - Intergenic
1109693863 13:65928104-65928126 GAAGAGAAGTTGAATGAGGAGGG + Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1111863469 13:93738657-93738679 TTGGAGTAGGAGAGAGAGGAGGG + Intronic
1112404964 13:99111294-99111316 TAGGAAAAGAGGAGTGGGGAAGG - Intergenic
1112833562 13:103484429-103484451 TAGCAGAAGTAGTATTAGGAAGG - Intergenic
1113081652 13:106526365-106526387 TAGGACAGGTAGAGTGGTGAAGG + Intronic
1113147236 13:107220863-107220885 TATGAGAAAGAGAGGGAGGAAGG + Intronic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1113561782 13:111287182-111287204 AAGGAGAAGGACAGTCAGGATGG - Intronic
1113678749 13:112227132-112227154 GAGGAGGAGAGGAGTGAGGAGGG - Intergenic
1114207020 14:20581611-20581633 TAGGAGAAGGAAGCTGAGGATGG - Intergenic
1114367969 14:22050597-22050619 TAGGAGGAAGAGAGAGAGGACGG + Intergenic
1114373152 14:22112392-22112414 TAGGAGAAGTTGGATGAAGAGGG + Intergenic
1114862666 14:26544437-26544459 TAGGTGATGCACAGTGAGGAGGG + Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115877717 14:37879408-37879430 TAGGAGAAGCAGAGTTGGGCTGG + Intronic
1116111306 14:40588084-40588106 AAGGAAAAGTAGATTTAGGATGG + Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116494078 14:45539406-45539428 TAGGAAGAGTAGAGGGAGGCAGG - Intergenic
1116803009 14:49463291-49463313 TATGACAAGTGGAGTGAGGTGGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117975015 14:61288624-61288646 TAGGAAAAGTTCTGTGAGGATGG + Intronic
1118418971 14:65577745-65577767 TAGGAAAAGTAGATTGGGGTAGG + Intronic
1118946150 14:70389296-70389318 TGGGAGAAGGAAAGTGTGGAAGG - Intronic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119626663 14:76183038-76183060 TAGCAGAGGTAAAGAGAGGAGGG - Intronic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1119931483 14:78551767-78551789 GGGGGGAAGTAGAGTGGGGAAGG - Intronic
1124180818 15:27471899-27471921 CAGGAGAAGTACAGTGAGTGGGG - Intronic
1124957776 15:34370922-34370944 GAGGAGAAGGGAAGTGAGGAAGG - Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1125932893 15:43612733-43612755 TGGAAGAGGTAGAGAGAGGAAGG - Intronic
1125945992 15:43712195-43712217 TGGAAGAGGTAGAGAGAGGAAGG - Intergenic
1126076094 15:44911250-44911272 AAGGAAAAGAAGAGAGAGGAAGG + Intergenic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1126685115 15:51241608-51241630 GAGGAGAAATCCAGTGAGGAAGG + Intronic
1126822789 15:52521326-52521348 TAGGAGAAGTAAAATGATCAGGG - Intronic
1127129177 15:55844177-55844199 AAGGAGAAGAAGGGAGAGGAAGG + Intronic
1127804018 15:62502013-62502035 TAGGACAAAGAGAGCGAGGAAGG - Intronic
1128104309 15:65031819-65031841 TATGAGAAGGAGAGTGAGATGGG + Intergenic
1128565097 15:68695879-68695901 TAGGAGAAATAGAGATAGGAGGG + Intronic
1130112479 15:80977175-80977197 GAGGAGAAATAGAGTAAGGCAGG - Exonic
1130119106 15:81031472-81031494 TGGGAGCAGTAGAGACAGGAGGG - Intronic
1130225956 15:82058687-82058709 GAGGAGGAGAAGAGGGAGGATGG - Intergenic
1131935253 15:97497114-97497136 TAAGAGAGGTAGAGAGAGAAGGG + Intergenic
1133366613 16:5215374-5215396 TAGAAGACGCAGGGTGAGGAAGG - Intergenic
1133399753 16:5476865-5476887 TGGGAGAACTAGATTGAGAAAGG - Intergenic
1133469258 16:6058341-6058363 TCTGAGAAGGAGAGGGAGGAAGG - Intronic
1133867068 16:9654255-9654277 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1133920618 16:10149740-10149762 TAGGAGTTCTGGAGTGAGGAGGG - Intronic
1134066626 16:11232546-11232568 TAGAAGAAGAAGAGTAAAGAAGG + Intergenic
1135686423 16:24501624-24501646 TAGGAGGAGGAGAGAGAGGTGGG - Intergenic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1138208876 16:55146199-55146221 TCAGAGAAGAAGAGAGAGGAGGG - Intergenic
1138255657 16:55556847-55556869 TAGGAGGATTTGAGTGGGGAAGG + Intronic
1138509003 16:57497194-57497216 TAGGAGAGGTTAAATGAGGATGG + Intergenic
1138594142 16:58020617-58020639 GAGGAGAGGAAGAGAGAGGAGGG - Exonic
1139328467 16:66169600-66169622 GAGGAGGAGGAGAGGGAGGAAGG + Intergenic
1139415477 16:66804998-66805020 AGGGGGAAGTAGAGTGAGGGAGG + Intronic
1139686177 16:68605425-68605447 CAGAGGAAGTAGAGTGTGGAAGG - Intergenic
1139800936 16:69522161-69522183 TAGGTGAAGAAGAGGGAGGAGGG + Intergenic
1141527065 16:84618324-84618346 AAGGAGAAGGAGAGAGAAGAGGG - Intergenic
1141621313 16:85238042-85238064 TAGGGGCAGTGGAGAGAGGAGGG + Intergenic
1141635674 16:85312745-85312767 GAGGAGAAGGAGGGGGAGGAAGG + Intergenic
1141734986 16:85846383-85846405 TAGAAGAAAGAGGGTGAGGAAGG - Intergenic
1141908304 16:87041853-87041875 AAGGAGAAGTGGAATTAGGAGGG - Intergenic
1142287788 16:89178469-89178491 TGGGAGAAGAAGAGTGAGGCTGG + Intronic
1143757060 17:9074912-9074934 TGGGAAACGCAGAGTGAGGACGG - Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144161136 17:12559340-12559362 TAGAAGAAGGAAAGAGAGGAAGG - Intergenic
1145221930 17:21096604-21096626 TAGGATAAGTTGGGTGGGGAAGG + Intergenic
1147129737 17:38400044-38400066 TAGGAGCAGGAGAGAAAGGAGGG + Exonic
1147613662 17:41815805-41815827 TTTCAGAAGTAAAGTGAGGATGG - Intronic
1147632522 17:41941284-41941306 CAGGAGAAGTCAAGTGAAGAAGG - Intronic
1148128509 17:45248712-45248734 AAGGTGAAGGAGGGTGAGGAGGG + Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148774425 17:50087674-50087696 TAGGATAGGAAGGGTGAGGATGG + Intronic
1149369076 17:55975217-55975239 AAGGAAAAGTGTAGTGAGGAAGG + Intergenic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1151410754 17:73926619-73926641 GAGGAGAAGGAGAGAGATGAGGG - Intergenic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1153106704 18:1536423-1536445 TAGGAGAAAGAAAGTGAGGAAGG - Intergenic
1153577676 18:6539143-6539165 AAAGAAAAGTAGAGTAAGGAGGG + Intronic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1154022143 18:10673502-10673524 TAGGTGAAGGTGGGTGAGGAGGG + Intronic
1154050734 18:10954595-10954617 GATGAGAAGAAGAGGGAGGAGGG + Intronic
1155011513 18:21783537-21783559 TAGAAGACATAGAGTGAGGCCGG - Intronic
1155827673 18:30468547-30468569 TAGCTGGAGTGGAGTGAGGAAGG + Intergenic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1157319991 18:46626813-46626835 TAGATGAAGGAGACTGAGGAAGG - Intronic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1158907329 18:62026689-62026711 TAGCAGAGGCAGAGTCAGGAAGG - Intergenic
1159097711 18:63923181-63923203 TCTGAGGAATAGAGTGAGGAGGG - Intronic
1159408346 18:68036004-68036026 TAGGTCAATGAGAGTGAGGATGG + Intergenic
1159915400 18:74183191-74183213 GAGGAGAAGTAGGGGGAGGTGGG - Intergenic
1159946873 18:74450547-74450569 TGTGAAAAGCAGAGTGAGGAGGG + Intronic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1162319220 19:9960883-9960905 TAGGAGAACTGGTGAGAGGAGGG + Exonic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163611526 19:18304383-18304405 GAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1163779166 19:19237197-19237219 AAGGAAAAGTAGGCTGAGGATGG - Intronic
1163779612 19:19239576-19239598 TGGGAGGAGGAGAGGGAGGAGGG - Intronic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1166017631 19:39994857-39994879 CAGGAGCAAGAGAGTGAGGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167725016 19:51205553-51205575 CATGAGAAAGAGAGTGAGGAAGG - Intergenic
1167757635 19:51422314-51422336 TGAGAGAAGTGGAGTGACGATGG - Intergenic
1168290262 19:55354124-55354146 TAGGAGGAGCAGTGTGAGGGAGG - Exonic
1168375149 19:55870789-55870811 CACGAGAAGGAGAGTGAAGAGGG - Intronic
926244421 2:11112768-11112790 CAGCAAAAGTACAGTGAGGAAGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926653782 2:15376056-15376078 TAGGGGAACTAGAATGAGGAGGG + Intronic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
926960823 2:18356696-18356718 TAAGAGAAGAAAAGAGAGGAGGG + Intronic
926978802 2:18544246-18544268 TCAGAGAAGTAGAGATAGGAAGG - Intergenic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
928126779 2:28621954-28621976 TAAGAGAAGTGAAGTGAGAAAGG - Intronic
928176202 2:29035870-29035892 TAGCAGATTTACAGTGAGGAGGG + Intronic
928656536 2:33457800-33457822 TAGGAGAGGTAGTGTGGTGAGGG - Intronic
928951464 2:36817159-36817181 TAGGAAGGGGAGAGTGAGGAAGG + Intergenic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
930975493 2:57454433-57454455 TATGAGAAGGAGAGTAAGGCAGG - Intergenic
930990166 2:57644836-57644858 TAGGAAAATTAGAGTGGTGATGG - Intergenic
931577073 2:63729478-63729500 TAGGAGAAGTAGCCTGTTGAAGG + Intronic
931895265 2:66721756-66721778 AAGGAGAAGAAGAGAGATGAGGG - Intergenic
931996928 2:67847708-67847730 TAGGTGAAGTTGTGAGAGGAGGG - Intergenic
932782496 2:74569674-74569696 CAATAGAAGTAGAGTGAGGGAGG - Intronic
934702170 2:96451334-96451356 TAGGAGCATGAGGGTGAGGAGGG - Intergenic
937218202 2:120326031-120326053 GAGGAAAAGTAGAGCGAGGAGGG + Intergenic
938980548 2:136522233-136522255 AAGGAGAAGCACAGTGAGAAGGG - Intergenic
939438360 2:142208267-142208289 AAGGACAAGAAGAGTGAGAAAGG - Intergenic
939895807 2:147790221-147790243 TAGGAAAAGAAGATTCAGGATGG - Intergenic
940766500 2:157795811-157795833 AAGGAGAGGTAGAGAGAGAATGG - Intronic
941111351 2:161421739-161421761 TAAGAGAAGTAGAGGGAGGCAGG - Intronic
941284869 2:163598231-163598253 TGGGGGAGGCAGAGTGAGGAAGG - Intronic
941754613 2:169171639-169171661 CCAGAGAAGTAGAGGGAGGAAGG - Intronic
941893300 2:170604961-170604983 TAAGAGAAGAAGGGTGAGGGAGG - Intronic
941937871 2:171000609-171000631 TAGGTTGAGTAGACTGAGGAGGG + Intronic
941947763 2:171118958-171118980 TAGAAGAAGTAGACAGAGGAAGG - Intronic
942075365 2:172352351-172352373 GAGATGAGGTAGAGTGAGGAAGG + Intergenic
942661259 2:178267431-178267453 TGGGAGAAGTGAAGTGGGGAAGG - Intronic
942771542 2:179526711-179526733 TAGGAGAAGCAGTGTCAGCAAGG - Intronic
942813724 2:180026607-180026629 AAGGAGAAATAGAGTGAAGTGGG + Intergenic
942823876 2:180150149-180150171 CAGGTGAGGTAGAGTTAGGAAGG + Intergenic
942891758 2:180998444-180998466 TGGGATAAGGAGAGTGGGGAAGG + Intronic
942980137 2:182070878-182070900 TAGGAGGAAGAGAGGGAGGAGGG + Intronic
943008405 2:182415628-182415650 TAGAAGAAGTAAAGACAGGAGGG - Intronic
943060950 2:183040775-183040797 AAGGAGGAGGAGAGGGAGGAGGG + Intergenic
945633982 2:212323413-212323435 TAGGAAAGGTAGTGTGGGGAAGG + Intronic
945702394 2:213188404-213188426 TCAGAGAAGCAAAGTGAGGAGGG - Intergenic
946400938 2:219468211-219468233 TCTGAGAAGTAGATGGAGGAGGG + Intronic
946630050 2:221657169-221657191 TAGGAGAAGTGGAGGGCTGAGGG + Intergenic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
1168915525 20:1482554-1482576 AAGGAGAAAGAGAGAGAGGAAGG - Intronic
1168977427 20:1978007-1978029 TAGAAAATGCAGAGTGAGGAAGG - Intergenic
1170748796 20:19125094-19125116 TGGGAGAGGTAGAGTGGCGAGGG + Intergenic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171193725 20:23180607-23180629 TCGGAGCAATAGACTGAGGAAGG - Intergenic
1174317238 20:49713006-49713028 TAGGGGAAGTAGAGGAAGAAAGG + Intronic
1174716812 20:52767584-52767606 AAGGAGAACTAAAGTGAGGATGG - Intergenic
1175211084 20:57355771-57355793 TAGGAGAACAGGAGGGAGGATGG + Intronic
1175665230 20:60852946-60852968 TAGGCCAAGAAGAGGGAGGAGGG + Intergenic
1175741918 20:61425523-61425545 TAGGAGAAGGACAGTGGGCAGGG + Intronic
1175872033 20:62213367-62213389 TGGGGGAAGGAGAGTGGGGATGG + Intergenic
1175881514 20:62262139-62262161 TAGGAGCAGGAGTGTGAGGCCGG - Intronic
1177187550 21:17814634-17814656 TAGGAGGAAGAGAGTGAGGGGGG + Intronic
1178777063 21:35561948-35561970 GAGGAGGAGGAGAGAGAGGAAGG + Intronic
1179142861 21:38742003-38742025 TATGAGAAGTAGCTTGAGGGTGG - Intergenic
1179305091 21:40146289-40146311 TCAGAGAAGTAGAAGGAGGATGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1181148166 22:20863548-20863570 GAGGAGAAGTAGTGGGAGCAGGG + Intronic
1181397026 22:22629903-22629925 TGAGAGACGTAGAGTAAGGAGGG - Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181471959 22:23145975-23145997 CAGTGGAAGTAGAGTGGGGAGGG - Intronic
1181776101 22:25161113-25161135 AAGGAGAAGGAAAGTTAGGAAGG - Intronic
1181962603 22:26633631-26633653 TATGAGAAGGAGAGAGAAGAGGG - Intergenic
1182497376 22:30719188-30719210 AAAGAGAAGGGGAGTGAGGAGGG - Intronic
1183392387 22:37552794-37552816 TGGGAGCAGTAGGGTCAGGATGG - Intergenic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183987653 22:41578267-41578289 CAGGAGAGGTAGGGGGAGGACGG + Intronic
1184164940 22:42721319-42721341 GAGGAGGAGTAGAGAAAGGACGG - Intergenic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
950582545 3:13871940-13871962 TGGCTGGAGTAGAGTGAGGAAGG - Intronic
950908918 3:16567052-16567074 TGGTTGAAGTAGAGTGAGGGAGG - Intergenic
951237415 3:20251781-20251803 TAGGAGCAAGAGAGTGAGGGGGG + Intergenic
951710505 3:25581508-25581530 TAGAAGCAGTAGCGTGAGCAGGG + Intronic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
952330159 3:32357339-32357361 TAGAAGCAGTGGAGAGAGGAGGG - Intronic
952419579 3:33118973-33118995 TGGGAGAAGAAGAGGGAGAAAGG - Intronic
952945859 3:38477635-38477657 TAGGACAAATAGGGTGTGGAAGG - Intronic
953694425 3:45146456-45146478 GAGGAGGAGGAGAGAGAGGAGGG - Intergenic
955249954 3:57270863-57270885 TAGGAGAAGTTGACCAAGGAAGG + Exonic
955345489 3:58158170-58158192 TAGGGGATATAGACTGAGGAGGG - Intronic
955395669 3:58555564-58555586 TAGGAGCAGGAGTGTGATGAGGG - Intergenic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
956953035 3:74304296-74304318 TAGGAGAAGGAGAGGGAGAGAGG - Intronic
957347856 3:78984926-78984948 TAGGAGGAGGAGAAAGAGGAGGG - Intronic
957989893 3:87614496-87614518 GAGGAGGAATTGAGTGAGGAGGG + Intergenic
958194403 3:90224367-90224389 TGGGAGAAATAAAGTGTGGAAGG + Intergenic
958914304 3:100031396-100031418 TTTGGGAAGTGGAGTGAGGAAGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959758507 3:109928470-109928492 GAAGAGAGGTAGAGTAAGGAAGG + Intergenic
960416635 3:117393013-117393035 GAGAAGAAGTAGAGTGGGAAGGG - Intergenic
961289140 3:125831408-125831430 TGGGAGCAAGAGAGTGAGGAGGG + Intergenic
961345475 3:126260747-126260769 TGGGAGAAGAACAGGGAGGAAGG - Intergenic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
962068003 3:132003531-132003553 TAGAAGTAGTAGAGAGAGAAGGG - Intronic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
963071612 3:141309627-141309649 TAGGAGTTGGAGTGTGAGGAAGG - Intergenic
963075687 3:141344348-141344370 TAGAAGAAGAAGATGGAGGAAGG - Intronic
963774878 3:149428611-149428633 CAGGAGAAAGAGAGTGAGGGAGG + Intergenic
964490145 3:157227574-157227596 CAGGAGCAAGAGAGTGAGGAGGG + Intergenic
965172168 3:165279838-165279860 GAGGAGAAGAAGAGAGAAGAAGG - Intergenic
965264904 3:166531061-166531083 AAGGAGAATTAGAGTGAAGAGGG + Intergenic
965564288 3:170095617-170095639 TGGCAGAAGTCGAGTAAGGAGGG - Exonic
965599645 3:170442220-170442242 TGGGAAATGTAGACTGAGGATGG + Intronic
966313413 3:178619182-178619204 TAGGGGAAGGAGAGTGAGACTGG + Intronic
966666135 3:182472993-182473015 TAGAAGAAGAAGACTGAAGAGGG - Intergenic
966908573 3:184544755-184544777 GAGGAGGAGGAGAGGGAGGAGGG - Intronic
967210199 3:187161764-187161786 TAGGGGAAGCAGAGGTAGGAAGG - Intronic
969159738 4:5246557-5246579 TATGACAAGTTGAGAGAGGAAGG - Intronic
969501802 4:7558050-7558072 GAGGAGGTGTTGAGTGAGGAGGG + Intronic
969804851 4:9599295-9599317 TGGGAGCAAGAGAGTGAGGAGGG + Intergenic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
970501222 4:16679294-16679316 AAGGAGGAGGAGAGGGAGGAAGG + Intronic
970559576 4:17269479-17269501 TAGTAGGTGTGGAGTGAGGAGGG - Intergenic
971078086 4:23173714-23173736 TAGGAGAAATAGAGAGAGACTGG - Intergenic
971839521 4:31833470-31833492 TAGGTGAAATAGTGTGAGGATGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
972753284 4:42014915-42014937 TGGGAGGTGGAGAGTGAGGATGG + Intronic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
975553376 4:75635962-75635984 GAGGAGAAGTGGATTGTGGAGGG - Intergenic
976119765 4:81767104-81767126 TAGGAAAAGTAAAGTGAGAAAGG - Intronic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977677506 4:99764137-99764159 CAGGAAAAGTAGAGAGAGAAGGG - Intergenic
978192722 4:105933798-105933820 TGGGAGAAGGAGAGGGAGAAGGG - Intronic
978770919 4:112455905-112455927 TAGGAGCAGTTGTGTGAAGATGG + Intergenic
979687779 4:123529552-123529574 TAGGAGAGGTGGAGGGAGAAGGG + Intergenic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
981459988 4:145002059-145002081 AAGGAGAAGTAGTGAGAGTAGGG - Intronic
982048593 4:151475622-151475644 TGGCTGAAGTAGAGTGAGGGAGG + Intronic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
983671313 4:170241043-170241065 TGGCTGAAGTAGAGTGAGCAGGG - Intergenic
984118238 4:175709225-175709247 GAGGAGGAGAAGAGGGAGGAAGG - Intronic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984388758 4:179100070-179100092 TGGGAGAAGGAAAGGGAGGAAGG + Intergenic
984513216 4:180704587-180704609 TAGGAATAGTAGTGTGAGAAAGG - Intergenic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
984624781 4:181994990-181995012 TAAGAAAAGTAGAATGAGGCTGG + Intergenic
985286534 4:188341835-188341857 TAGGAGAAACTGAGTTAGGACGG - Intergenic
985828098 5:2207649-2207671 CACGCAAAGTAGAGTGAGGAAGG + Intergenic
986181041 5:5393186-5393208 TGGGAGAAATGGAGTGAGGCTGG - Intergenic
986360657 5:6975121-6975143 TAGGAGAAAGAGAGGGAGGGAGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987198857 5:15554291-15554313 GGGGAGATATAGAGTGAGGAAGG - Intronic
987729660 5:21752732-21752754 TAGAGGAAGTAGAGGAAGGAAGG + Intronic
987875648 5:23677167-23677189 GAGGAGTACTAGAGTGGGGAAGG + Intergenic
987906020 5:24078303-24078325 GAGGAGGAGTAGGGAGAGGAGGG + Intronic
987938444 5:24500901-24500923 GAGAAGAAGTGGAGAGAGGAGGG + Intronic
988031530 5:25769730-25769752 CAGGAGAAAGAGAGTGAGTAGGG + Intergenic
988125276 5:27024886-27024908 TAGGAGACATAGAGTTAGCACGG + Intronic
989243222 5:39223766-39223788 TAAGAGAATTAGAGTGGGGGTGG + Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990675444 5:58179048-58179070 CAGGAGAAGTAGAGAGAGAAGGG + Intergenic
990842569 5:60100145-60100167 TAGGAGCAGGACAGTGAGAAAGG + Intronic
991234207 5:64375466-64375488 TAAGACAAGTTGACTGAGGAAGG + Intergenic
992349242 5:75912040-75912062 TGGGAGAGGTGGAGTGAGGCAGG + Intergenic
992411131 5:76506279-76506301 TATGAGAATGAGGGTGAGGAAGG - Intronic
992866827 5:80965235-80965257 TGGGAGATGGAGAGTGTGGATGG + Intronic
993002893 5:82400011-82400033 TAAGAGAAGTAGAATGGGCAAGG - Intergenic
993139127 5:84008146-84008168 TTGCAGGAGTAAAGTGAGGATGG + Intronic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
994625416 5:102212730-102212752 CAGGAGAAGTAGAGTGAAAGAGG + Intergenic
996087554 5:119320527-119320549 GAGGAGTAGTGGAGTGGGGAGGG - Intronic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996780538 5:127181930-127181952 TAGGAGATGTGGAGGGTGGAAGG - Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997271702 5:132544858-132544880 TAGGAGAAGTAGAGGCAGCTGGG + Intronic
998192164 5:140035263-140035285 TTGGAGAAGTAGTTTGAGAAGGG - Intronic
998656389 5:144185162-144185184 GCTGAGCAGTAGAGTGAGGATGG + Intronic
998704355 5:144741311-144741333 TAGGAGAAGAAAAGGAAGGATGG - Intergenic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999287877 5:150405005-150405027 TAGGAGAGGTGGGGTGAGGGTGG - Intronic
999448142 5:151657934-151657956 TAAGGGAAGGGGAGTGAGGAAGG - Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000302479 5:159968722-159968744 GGGAAGAAGTAGAGTGAGGGAGG - Intronic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1002337623 5:178491143-178491165 TAGGAGGAGAAGAGAGAGAAAGG + Intronic
1003265035 6:4558195-4558217 TAGGAGAACCAGAGATAGGATGG + Intergenic
1003375509 6:5573276-5573298 TGAGAGAAATGGAGTGAGGAGGG - Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003529272 6:6924598-6924620 CAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1003637011 6:7841612-7841634 TATGATGAGGAGAGTGAGGAAGG + Intronic
1003704715 6:8512400-8512422 TAGAAAAAGAAGAGTGATGAGGG - Intergenic
1003767100 6:9250667-9250689 TAGGAAAAGAAGGGAGAGGAAGG - Intergenic
1004142229 6:13028901-13028923 TTGGATTAGTAGATTGAGGAAGG + Intronic
1004880542 6:20003085-20003107 TGGGAGAAGTGGAGTGGGGCTGG - Intergenic
1005419127 6:25630996-25631018 TGGGAGAGGTGGAGTGAGGAAGG + Intergenic
1005509224 6:26497398-26497420 TAAGAGAAGTGAAATGAGGAAGG + Intergenic
1006857435 6:37144977-37144999 AAGGAAAAGTAGAGTGGAGATGG - Intergenic
1006901523 6:37505501-37505523 TAGTAGATATAGATTGAGGAAGG + Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1008287326 6:49669968-49669990 TTAGAGAACTAGAGGGAGGAAGG - Intergenic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1011306043 6:85927980-85928002 TGGGAGTAGGAGAGTGGGGATGG - Intergenic
1011480022 6:87784566-87784588 AGGGAAAAGTAGAGTGAGGCAGG + Intergenic
1013300314 6:108799038-108799060 TTGGAAAAGTAGTGTGAGCAGGG - Intergenic
1013378684 6:109544539-109544561 CAGGAGAAAGAGAGTGAGGTGGG - Intronic
1013862353 6:114650953-114650975 TAGGACAAAGAGTGTGAGGATGG + Intergenic
1014143949 6:117974940-117974962 TAGGAGAATGAGAGTGATAAAGG + Intronic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1014831195 6:126104760-126104782 TGGGAGAAGAAGAGAAAGGAAGG - Intergenic
1015114087 6:129627616-129627638 AAGGAAAAATAGAGAGAGGAAGG + Intronic
1015398204 6:132758945-132758967 AAGGAGAAGTAGGGGGAGGATGG - Intronic
1015846553 6:137526045-137526067 TAGGAGAGAGAGAGTGAAGAAGG - Intergenic
1016499717 6:144705758-144705780 TAGGAAAAGTAAAGTGCTGAAGG + Intronic
1016637289 6:146307637-146307659 TATGAAAATTAGTGTGAGGAAGG + Intronic
1016919577 6:149278726-149278748 AAGGAGAAGTAGAGGAAGGAAGG + Intronic
1017056516 6:150441492-150441514 TAGGAGAAGGTGGATGAGGAGGG - Intergenic
1017625625 6:156345515-156345537 AAGGAGAGGGAGAGAGAGGAAGG + Intergenic
1017664344 6:156705023-156705045 TAGCAGCAGTAGAGGAAGGAAGG - Intergenic
1017669517 6:156756648-156756670 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1018621268 6:165731526-165731548 TAGAAAGAGAAGAGTGAGGAAGG + Intronic
1019057022 6:169231362-169231384 TGGGAGAAGCAGAGGGAGCACGG + Intronic
1020011402 7:4807704-4807726 GGGGAGAAGGAGAGGGAGGAGGG - Intronic
1021675492 7:23076532-23076554 TAGGGGAAGGACAATGAGGAAGG + Intergenic
1022108832 7:27215376-27215398 AAGGAGGAGGAGAGTGAAGAAGG - Intergenic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1022243602 7:28535612-28535634 TAGGAGAGAAAGAGGGAGGAAGG + Intronic
1022530230 7:31062404-31062426 AAGATGAAGTAGAGTGAGGTAGG + Intronic
1022835538 7:34110298-34110320 TGGGAGAAGCTGAGTGGGGAAGG - Intronic
1025003672 7:55339161-55339183 CAGAAGGAGTAGAATGAGGAAGG + Intergenic
1026487613 7:70834990-70835012 CAGGAGCAGGAGAGTGAGGGGGG + Intergenic
1026644816 7:72158427-72158449 TTGGAGAGGTGGAGTGGGGAAGG - Intronic
1027513288 7:79110098-79110120 TAGGAGAGCAAGAGTGAAGAAGG + Intronic
1027631614 7:80613063-80613085 AAGTAGTAGTAGAGAGAGGAGGG + Intronic
1027635366 7:80665916-80665938 TGGGAGAATTAAAGGGAGGAAGG + Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028674430 7:93442609-93442631 GAGGAGAGGTGTAGTGAGGAGGG - Intronic
1028865022 7:95699275-95699297 TAGGAGAAAGAGAGAGAGAAGGG + Intergenic
1029476136 7:100785959-100785981 GAAGAGAAAGAGAGTGAGGAGGG - Intronic
1030021203 7:105276952-105276974 CAGGAGAAGTAGAGTTAGGATGG - Intronic
1030184380 7:106746378-106746400 TAGGAGAAGTTCAGTAAGAAAGG - Intergenic
1031112192 7:117624476-117624498 TGGGAGCAGTAGAGTGAACATGG - Intronic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034193589 7:149229144-149229166 TAGGAGAATGAGATTGAGGATGG + Intergenic
1034210919 7:149361781-149361803 CAGGAGAACTAGAATTAGGAGGG + Intergenic
1034679203 7:152915798-152915820 AAGGAGAAGGAGGGTGAGAAGGG - Intergenic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034936289 7:155202922-155202944 GAGGAGCAGGAGAGAGAGGAGGG + Intergenic
1034950047 7:155290880-155290902 CAGGAGAAGCCGTGTGAGGACGG - Intergenic
1035144401 7:156799555-156799577 TAGGAGAAGGAGAGAGATGAAGG - Intronic
1035430329 7:158815342-158815364 TAGGAGCAGTAGTTTGAGGCTGG - Intronic
1035494183 7:159307644-159307666 TATGAGAATTGGAGTGAGGACGG + Intergenic
1035713979 8:1739707-1739729 TGAGACAAATAGAGTGAGGATGG - Intergenic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1036103145 8:5809688-5809710 TAGGAAAAGCAGAGTGATGTTGG - Intergenic
1036394014 8:8351226-8351248 TAGGAGGAAGAGAGTGAGGGAGG + Intronic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037631070 8:20656873-20656895 TTGGATAAGAAGGGTGAGGAGGG - Intergenic
1038248934 8:25884500-25884522 TAAGGGAAGGAGAGTGAGGGAGG - Intronic
1038539840 8:28383412-28383434 TAGGAGAGAGAGAGTGAGGCAGG - Intronic
1039507720 8:38064065-38064087 TGGGTGAGGTAGAGGGAGGAGGG + Intergenic
1040361990 8:46674360-46674382 TGAGAGAACTAGAGGGAGGAAGG + Intergenic
1040639182 8:49312407-49312429 AAGAAGAAGTAGAGAGAGAAAGG + Intergenic
1040891065 8:52316641-52316663 TAGGAAATGTAATGTGAGGATGG - Intronic
1041392361 8:57358445-57358467 CAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1041884480 8:62792662-62792684 AAGGAAAAGTGGATTGAGGAAGG + Intronic
1042115582 8:65427498-65427520 TTTGACAAGTAGAGAGAGGAAGG + Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043086172 8:75836170-75836192 TAGTAGAAGAAGACTGAGGGAGG - Intergenic
1043636523 8:82391018-82391040 GAAGAGGAGGAGAGTGAGGAGGG - Intergenic
1043675872 8:82952990-82953012 CAAGAGAGGGAGAGTGAGGAGGG - Intergenic
1044734564 8:95266941-95266963 TAGGAGAACTAGCATGCGGAGGG - Intronic
1044871559 8:96625329-96625351 GAGGACAAGAGGAGTGAGGAAGG - Intergenic
1045130034 8:99140678-99140700 GAGGAGGAGGAGGGTGAGGAAGG - Intronic
1045585763 8:103535225-103535247 TAGCAGAAGTAGAGTAAGTTTGG + Intronic
1045781244 8:105865571-105865593 TAGTAGAAATAGAGACAGGATGG - Intergenic
1046200463 8:110921157-110921179 TATTAAATGTAGAGTGAGGAGGG + Intergenic
1046494779 8:114999025-114999047 AAAGAGAGGTAGAGTGAAGAAGG - Intergenic
1046682126 8:117182157-117182179 CATGAGAAGGAGAGTGAGGTGGG + Intergenic
1047154516 8:122301943-122301965 TAGGAGAAGAACAGTGATGTGGG + Intergenic
1047676823 8:127211844-127211866 TTGGGGGAGTTGAGTGAGGAGGG - Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048182891 8:132212749-132212771 GAGGTGAAGCAGAGTGAGGCGGG - Intronic
1048226227 8:132588873-132588895 TAGGAGCAAGAGAGAGAGGAAGG + Intronic
1048392422 8:133980301-133980323 GAGGAGAAATAGAGTGTAGATGG - Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048803886 8:138221285-138221307 TAGGAGCAATAGAGAGAGCAGGG + Intronic
1050785398 9:9394850-9394872 AAGGAGGAGTAGAGTGGGCAGGG - Intronic
1052259652 9:26499272-26499294 AAAAAGAAGTAGAGTGAGGTTGG + Intergenic
1052323911 9:27196726-27196748 CAGGAGCAGAAGAGTGAGGGGGG + Intronic
1053102257 9:35380888-35380910 TAGGAGAACAGGAGTGTGGAGGG - Intronic
1053103609 9:35391773-35391795 CAAGAGAAGTAGTGTGAGGTGGG + Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053296476 9:36918031-36918053 TAGGAGAAGAAGAGAGATGAGGG - Intronic
1054858847 9:69929302-69929324 TTGAAGAAATAGAGTCAGGAAGG - Intergenic
1055441608 9:76342273-76342295 TTGGATTAGTAGAGTGAGGCTGG - Intronic
1056128260 9:83558364-83558386 TTGGAGAAGTAAAGTGAAAATGG + Intergenic
1056238314 9:84618048-84618070 TAGGAGGAAGAGAGGGAGGAAGG - Intergenic
1056519766 9:87389438-87389460 TAGGGAAAGCTGAGTGAGGAAGG - Intergenic
1056789915 9:89618593-89618615 CAGGAGAAGCGGTGTGAGGAGGG - Intergenic
1057115258 9:92514840-92514862 GAGGAGGAGGAGGGTGAGGAGGG - Exonic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057497418 9:95571969-95571991 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1057867773 9:98694739-98694761 TCGGAGAAAGAGAGAGAGGAAGG - Intronic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059172048 9:112134593-112134615 GAGGACAAATAGAGGGAGGAGGG + Intronic
1059674780 9:116527827-116527849 TAGGAAAGGGAGAGTGAGGGGGG - Intronic
1059772610 9:117441940-117441962 TAGGAAAAGGTGGGTGAGGATGG + Intergenic
1060675880 9:125514154-125514176 TAGGTGAAGAAGAGGGAAGAGGG - Intronic
1061275567 9:129568098-129568120 TTGGAGAGGAAGAGTGGGGAGGG - Intergenic
1061865664 9:133490768-133490790 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1203445057 Un_GL000219v1:46145-46167 TGGGTGAAGTCTAGTGAGGAGGG + Intergenic
1185729708 X:2451540-2451562 TAGGGGAAGAAGAATGTGGACGG + Intronic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189178736 X:38983117-38983139 AAGGAGGAGGAGAGTGAAGAGGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189364992 X:40381193-40381215 TGGGAGAGGTGGAGGGAGGAGGG - Intergenic
1189857612 X:45239026-45239048 AAGGGGAAATAGAGTAAGGAAGG - Intergenic
1189952790 X:46249490-46249512 TAGATCAAGTAGAGTGAGCAAGG + Intergenic
1190048010 X:47128002-47128024 CAGGAGAAGGAGAGAGAGGTAGG + Intergenic
1190221812 X:48516747-48516769 GAGCAGAGGTAGGGTGAGGAGGG + Intronic
1191099369 X:56708902-56708924 TAGCTGAAGTAGTGTTAGGAGGG - Intergenic
1191724069 X:64260308-64260330 CAGGAGCAGGAGAGTGAAGAGGG - Intergenic
1192430949 X:71111259-71111281 AAGAAGAAGTAGCGTGAGGCAGG + Intronic
1193593863 X:83422202-83422224 TTGGAGAAGGAGAGAGAGAAGGG - Intergenic
1194744099 X:97609583-97609605 TAGGAGAAAAAGGGTGAGGCTGG - Intergenic
1195348712 X:103976678-103976700 TAGGAGAATGAGAGTGAAAAGGG - Intergenic
1195356073 X:104040781-104040803 TAGGAGAATGAGAGTGAAAAAGG - Intronic
1195358730 X:104062162-104062184 TAGGAGAATGAGAGTGAAAAGGG + Intergenic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196417983 X:115493333-115493355 TAGTACAAGAAGAGTGAGTAAGG - Intergenic
1196586612 X:117436473-117436495 TAGGAGAAGCAAAGAGTGGAGGG + Intergenic
1197371044 X:125626940-125626962 TATGAGAAGCAGTGTCAGGACGG + Intergenic
1198230449 X:134684099-134684121 TGGGAGAAGGAGACTGAGAATGG + Intronic
1198376464 X:136045096-136045118 TAGGGGAGGGAGAGTGAGGAGGG + Exonic
1198631261 X:138641318-138641340 GAGGAGAAGAAGAGAGAGGTGGG - Intronic
1198766711 X:140087746-140087768 TAGGAGGAGTAGAGTATTGAAGG + Intergenic
1199394492 X:147318818-147318840 TAGGAGAATGGGATTGAGGAAGG - Intergenic
1199868110 X:151872500-151872522 GAGGAGCAGTAGAGTAAGGAGGG + Intergenic
1201887717 Y:18904040-18904062 GAGAAGAAATAGAGAGAGGAAGG + Intergenic
1202240924 Y:22768534-22768556 TAGGAGAAAAAGAGCAAGGATGG + Intergenic
1202393910 Y:24402277-24402299 TAGGAGAAAAAGAGCAAGGATGG + Intergenic
1202476875 Y:25267815-25267837 TAGGAGAAAAAGAGCAAGGATGG - Intergenic