ID: 1094701612

View in Genome Browser
Species Human (GRCh38)
Location 12:32875780-32875802
Sequence AGACTACAGCAGGAGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 353}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094701608_1094701612 -6 Left 1094701608 12:32875763-32875785 CCAGGTTTGAAAATAGTAGACTA 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1094701612 12:32875780-32875802 AGACTACAGCAGGAGGAGATGGG 0: 1
1: 0
2: 1
3: 30
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094701612 Original CRISPR AGACTACAGCAGGAGGAGAT GGG Intronic
900033591 1:388919-388941 GGACCAAAGCAGGAGGAGAGGGG - Intergenic
900054426 1:618809-618831 GGACCAAAGCAGGAGGAGAGGGG - Intergenic
900926141 1:5707352-5707374 AGACTGCAGCATGTGGAGATCGG - Intergenic
901708185 1:11092579-11092601 AGACTGCAGCAAGCTGAGATTGG - Intronic
902081020 1:13820741-13820763 AGGCCACAGCAGCAGGAGCTGGG - Intronic
902594121 1:17496355-17496377 AGAAAACAGCAGAAGCAGATGGG + Intergenic
902957689 1:19937073-19937095 AGACGATAGCAGGAGGTAATAGG + Intergenic
903296085 1:22343855-22343877 AGACTAAAGCAGGTGGGGGTGGG + Intergenic
903661330 1:24980617-24980639 AGACAAGAGGAGGAGGTGATGGG + Intergenic
904660938 1:32084294-32084316 AGACTGCAGCAGGAGGAGGAAGG - Intronic
905793225 1:40801277-40801299 AGAACAAAGGAGGAGGAGATAGG - Intronic
907287383 1:53390530-53390552 AGACAGCAGAAGGAGGAGAAGGG + Intergenic
907806802 1:57828417-57828439 AGATTACTGCAGCAGGAGGTGGG - Intronic
908119725 1:60974758-60974780 AGAGCACAGCAGGGGGAGATGGG + Intronic
908599409 1:65722942-65722964 ATATTCTAGCAGGAGGAGATAGG - Intergenic
909175116 1:72347532-72347554 AGACTGCAGGAGGATGAAATTGG + Intergenic
911493525 1:98600171-98600193 AGACTAAAACAGGAGGTGAGTGG - Intergenic
911852631 1:102838609-102838631 AGACTCCAGCAGAAAGACATTGG + Intergenic
913049408 1:115103824-115103846 AGAATACTGCAGGAGGTGAGGGG + Intergenic
913286935 1:117235222-117235244 AGACTACAACATGAAGAGATTGG + Intergenic
915012308 1:152699016-152699038 GGACCACAGCAGGAAGAGACTGG - Exonic
915021925 1:152787414-152787436 ACACTGCAGCAGGAAGAGACTGG - Exonic
915022887 1:152797897-152797919 ACACTGCAGCAGGAAGAGACTGG - Exonic
915023612 1:152805342-152805364 ACACTGCAGCAGGAAGAGACAGG + Exonic
915024254 1:152812561-152812583 ACACTGCAGCAGGAAGAGACTGG - Exonic
915025695 1:152827587-152827609 ACACTGCAGCAGGAAGAGACTGG - Exonic
915462742 1:156079973-156079995 ACACTGCAGCAGGAGGAGGGAGG + Intronic
916082200 1:161241124-161241146 AGACTACAGGAGAAGGACAAGGG + Intergenic
916444014 1:164855300-164855322 TGAACACAGCAGGAGGAAATTGG - Intronic
916738100 1:167626102-167626124 GGACTGCAGCGGGAGGATATTGG - Intergenic
917598860 1:176556055-176556077 AAAGTACAGCAAGAGGAGAGAGG + Exonic
917847842 1:179036895-179036917 AGACTTTATCAGGAGGAGATTGG + Intronic
918138492 1:181699861-181699883 AGACTAGAGGAGGAGAAGTTTGG + Intronic
918150828 1:181796879-181796901 AGTCTACAGCAGAAGGACAGGGG + Intronic
918592238 1:186253099-186253121 AGAATAAACCAGGTGGAGATGGG - Intergenic
918833376 1:189428237-189428259 GGAGCACAGCAGGAGGACATTGG - Intergenic
918842295 1:189557731-189557753 AGACTTCAGGAGGAGAACATTGG + Intergenic
919023297 1:192136274-192136296 AGGCCACAGCAGGAGGTGAGCGG - Intergenic
919620477 1:199859708-199859730 AGACTGTAACAGGAAGAGATAGG + Intergenic
919886160 1:201936491-201936513 AAACTAGAGCAGGAGGAGTGGGG - Intronic
920515371 1:206581256-206581278 AGAGTACAGCGGGAGCAGACAGG + Intronic
920732907 1:208504828-208504850 AGAGAACAGCAGGTGGGGATGGG - Intergenic
922070972 1:222193212-222193234 GGACAACAGCAGCAGGAGTTGGG - Intergenic
922336787 1:224624525-224624547 TGACTACAGAAGGAGCAGATGGG - Intronic
923263108 1:232286065-232286087 ACATTTCAGCATGAGGAGATGGG - Intergenic
923329506 1:232909578-232909600 AGACCACGGCAGGATTAGATGGG + Intergenic
923771907 1:236944888-236944910 AGCCTACAGAAGGATGAGAATGG + Intergenic
1064988163 10:21231755-21231777 AGGCATCAGCAGGAGGAGGTAGG + Intergenic
1065169818 10:23015334-23015356 AGACTAAGGAAGGAGGAGAGTGG - Intronic
1066139904 10:32494233-32494255 AGACTACAGAAGAATGAAATAGG - Intronic
1067327561 10:45284356-45284378 AGACTCCAGCAGAAAGACATTGG + Intergenic
1067790182 10:49281847-49281869 AGACCAAAGCAGGTGGATATAGG - Intergenic
1070486048 10:76932790-76932812 AGACTGGAGCAGGAGGAACTTGG - Intronic
1073367711 10:102957337-102957359 AGATTTCAGCTGGTGGAGATAGG + Intronic
1073773955 10:106765661-106765683 AGTCTACAGCAGATGAAGATGGG + Intronic
1074032473 10:109702488-109702510 AGACTACAGCACAAGAGGATGGG - Intergenic
1075482071 10:122790198-122790220 AAAAGACAGCAGGAGGAGAGGGG + Intergenic
1075703996 10:124488054-124488076 AGCCTGCAGCAGGAGGAAATGGG - Intronic
1075961014 10:126567760-126567782 AGACTGGAGCAGGTGGAGAAGGG + Intronic
1076480577 10:130782682-130782704 GGGCTACAGCGAGAGGAGATGGG + Intergenic
1077588516 11:3473215-3473237 AGAGTACAGCAGAAGGAGCCGGG + Intergenic
1077777389 11:5286452-5286474 AGACTACACCATGTGGAGAAGGG - Intronic
1080163256 11:29204854-29204876 ATCCAACAGCAGGAGAAGATGGG - Intergenic
1081692275 11:45086601-45086623 AGACTAGAGCAGGAGGTGCTGGG - Intergenic
1081776518 11:45679253-45679275 AGACTCTAGCAGGAGGCGGTGGG + Intergenic
1082783564 11:57304219-57304241 GGATTAAAGCAGGAGGAGAGTGG + Intronic
1083104682 11:60346416-60346438 AAACTACAGCAGCAGGTGATAGG - Intronic
1083434705 11:62634373-62634395 AAACTGGGGCAGGAGGAGATGGG + Exonic
1083591103 11:63895385-63895407 ACACTCCAGCAGGTGGTGATGGG + Intronic
1084244221 11:67844844-67844866 AGAGTACAGCAGAAGGAGCCGGG + Intergenic
1088283875 11:108165733-108165755 AGACTAAAGCAGGAGGAGAGTGG - Intronic
1088760689 11:112926317-112926339 AGACTCCAGCAGAAAGAAATTGG - Intergenic
1088770355 11:113029571-113029593 AGATGACAGCAGGAGGAGTCAGG + Intronic
1088777420 11:113099301-113099323 AGAAAACATCATGAGGAGATGGG + Intronic
1090634470 11:128682162-128682184 AGGTTACAGCAGCAAGAGATTGG - Intergenic
1091838771 12:3604551-3604573 AATTTACAGCAGGAGAAGATTGG + Intergenic
1093245839 12:16735462-16735484 AGAGTAGAGCAGGAGTTGATTGG + Intergenic
1093536178 12:20226235-20226257 AGACCACAGATGGAGGAGAGAGG + Intergenic
1093618287 12:21254940-21254962 AGACTAAAGCAGGAAGAAGTTGG - Intergenic
1094121239 12:26976939-26976961 AGAGTCCAGCAGCAGGAGAAGGG - Intronic
1094701612 12:32875780-32875802 AGACTACAGCAGGAGGAGATGGG + Intronic
1094813709 12:34164655-34164677 AAAATGCAGCAGGAGGAGATGGG + Intergenic
1095199522 12:39366178-39366200 AGCCTACAACATGAGGAGATTGG + Intronic
1095860128 12:46907745-46907767 AGACTGCTGCAGGGGGAGAGGGG - Intergenic
1096718075 12:53502892-53502914 AGTCTTCAGCAGGGGGAGGTTGG + Intronic
1098798062 12:74918911-74918933 TGACTACATGAGGAGGAGAAAGG + Intergenic
1098876505 12:75871622-75871644 AGACTGCAGGAGGAGCAGGTTGG - Intergenic
1101025158 12:100596062-100596084 AGACTACAGCTGCAGAATATAGG - Intronic
1101084320 12:101220192-101220214 AGATTCTAACAGGAGGAGATAGG - Intergenic
1101174387 12:102134392-102134414 AGACTACATCATGAAGAAATAGG + Intronic
1102307777 12:111818764-111818786 AGACTCCAGCAGAAAGACATTGG - Intergenic
1102641614 12:114371950-114371972 ACACTACACCAGCAGGAGAAGGG + Intronic
1103472562 12:121193478-121193500 TGAGTCCAACAGGAGGAGATTGG + Intergenic
1103850859 12:123932421-123932443 AGGATACAGAAGGAGGAGAAAGG - Intronic
1105504710 13:20999578-20999600 TGACTACAGGAGGCTGAGATGGG - Intronic
1105834305 13:24195106-24195128 AGCCTGGAGCAGGAGGAAATGGG - Intronic
1105983941 13:25547277-25547299 GCCCTACAGCAGGAGGAGAGTGG + Intronic
1105991551 13:25627129-25627151 AGACTCCAGGAGAATGAGATGGG + Intronic
1106196412 13:27497918-27497940 AGACTACAGAAGTAAGAGACGGG - Intergenic
1107604809 13:42047707-42047729 GGACTAGAGCAGGAGGAAGTGGG - Intronic
1107612177 13:42126428-42126450 AGCCTACAGCAGGAGTATGTAGG + Intronic
1109498750 13:63210948-63210970 AGACTACAGGAAGAGGAGCAGGG - Intergenic
1109528323 13:63605850-63605872 GGACTACAGCAGAAGGAGGCTGG - Intergenic
1109563755 13:64083345-64083367 AGATTGCATCAGGAAGAGATTGG + Intergenic
1111694683 13:91608560-91608582 TGACTGCAGCAGCAGCAGATAGG + Intronic
1111978896 13:94996575-94996597 AGAAGACATCAGCAGGAGATTGG - Intergenic
1112801002 13:103109799-103109821 ACAGAACAGCAGGAGGAGACTGG - Intergenic
1112835111 13:103505206-103505228 AGACTAAAGCAGGAAGAAGTTGG - Intergenic
1113453853 13:110433242-110433264 AGCCTGGAGCAGGATGAGATGGG + Intronic
1113627390 13:111856986-111857008 AGACTGCAGGAGGAGGTGACGGG - Intergenic
1114568531 14:23649598-23649620 AGACTATGGGAGAAGGAGATGGG - Intergenic
1114885440 14:26843916-26843938 AGAAAAAAGCAGGAGGAGAGGGG - Intergenic
1115013833 14:28585626-28585648 GGGCTAGGGCAGGAGGAGATGGG + Intergenic
1116302706 14:43205806-43205828 AAACTACAGAAGGAAGAGAGTGG + Intergenic
1116508672 14:45716698-45716720 ATTCTCCAGCAGGGGGAGATGGG + Intergenic
1118171939 14:63396196-63396218 AGAGGAGAGGAGGAGGAGATGGG + Intronic
1118879592 14:69815121-69815143 AGACTCCAGCAGAAAGACATTGG + Intergenic
1119704771 14:76776711-76776733 ACACTTGAGCAGGAGGTGATAGG + Intronic
1122895939 14:104757041-104757063 AGACCAGAGGAGGAGGAGGTGGG - Intronic
1123962039 15:25413527-25413549 AAACTAAAGCAGGAGGACTTAGG - Intronic
1126717351 15:51533146-51533168 AGACCACAGGAGAGGGAGATTGG + Intronic
1128134194 15:65250634-65250656 AGTCTGCAGCAGTAGGAGAAGGG - Intronic
1128604458 15:69026584-69026606 AGACCATTGCAGGAGAAGATGGG + Exonic
1129832961 15:78682510-78682532 AGACTTCAGAAGGAAGAGAAAGG + Intronic
1130145705 15:81272338-81272360 GGTCTACAGCAGGAAGAGAAGGG - Intronic
1130886359 15:88095931-88095953 TGACCACTGCAGAAGGAGATTGG - Intronic
1131667417 15:94585231-94585253 AGACAAAGGCAGGAGGAGAAAGG - Intergenic
1132728693 16:1350057-1350079 AGCCCCCAGGAGGAGGAGATCGG - Exonic
1137816420 16:51402021-51402043 AGACCAAAGCAGGCGGAGAAAGG - Intergenic
1138246194 16:55468811-55468833 AGAACACAGCAGGGAGAGATGGG + Intronic
1139845674 16:69919560-69919582 AGACTCCAGCAGGTGGAACTGGG - Intronic
1140451392 16:75073784-75073806 AGAATACAGCACGAGGATGTTGG - Intronic
1141688795 16:85585130-85585152 AGACAACAGCAGGTGGAAAGCGG - Intergenic
1143483613 17:7240610-7240632 AGTCTACAGCAGGATGGGAAAGG + Exonic
1144886329 17:18465134-18465156 AGATTAAAACAGGAGCAGATTGG - Intergenic
1145092264 17:19995716-19995738 AGGCTGAAGCAGGAGGAGAATGG - Intergenic
1145145877 17:20479177-20479199 AGATTAAAACAGGAGCAGATTGG + Intergenic
1146583143 17:34057916-34057938 TTACTACTGCAGGAGGAGGTGGG - Intronic
1146721758 17:35129093-35129115 ATAGCACAGCAGGAGGAGATTGG - Intronic
1147286317 17:39405017-39405039 AGACACCAGCAGCAGAAGATAGG + Intronic
1147344198 17:39777073-39777095 AAAATACAGCAGAATGAGATGGG - Intronic
1149113713 17:53064970-53064992 AGATGACAGCAGGTGGAGGTGGG + Intergenic
1149423742 17:56534946-56534968 AGACTACAGCATGAAGAAAACGG + Intergenic
1149627042 17:58087062-58087084 ACACTACAGAAGGAGCAGAGAGG - Exonic
1149754222 17:59174338-59174360 AGACTTCATCATGAGGAGGTAGG - Intronic
1151934848 17:77255358-77255380 AGGCCCCAGCAGGAGGAGCTGGG - Intergenic
1151961141 17:77406239-77406261 AGACCAAAGCAGGAGAAGCTGGG - Intronic
1152367466 17:79864878-79864900 AGGCCACAGCAGGAGGAGGGAGG - Intergenic
1153269391 18:3304773-3304795 AGGCTGAAGCAGGAGGAGTTGGG + Intergenic
1153747887 18:8198965-8198987 AGACTAGAGGAGGAGGAGGCTGG + Intronic
1155086395 18:22463352-22463374 AGGCTACAGCACCAGGAGAGAGG - Intergenic
1155375803 18:25156106-25156128 TGACCACAGCAGGCGGAAATGGG + Intronic
1156744512 18:40372518-40372540 AGACTTCAGCAAGAATAGATAGG - Intergenic
1157930226 18:51813511-51813533 AGACTACACCAGGATCACATGGG - Intergenic
1157940180 18:51920042-51920064 AGACGGAAGCAGGAGAAGATGGG - Intergenic
1159043627 18:63347655-63347677 AGACCACAGAAGGAAGAGATGGG + Intronic
1162258251 19:9510629-9510651 AGACTCCAGCAGAAAGACATTGG - Intergenic
1162622650 19:11856146-11856168 AGACTCCAGCAGAAAGACATTGG - Intronic
1162971518 19:14183747-14183769 AGCCACCAGCAGGAGGAGAGGGG - Intronic
1163153333 19:15427531-15427553 AGGCTGCAGCAGGAGGAGAAAGG + Exonic
1163847549 19:19646119-19646141 AGACTTCAGCAGGAGAGGCTGGG - Intronic
1164290982 19:23868608-23868630 AGACTGCAGCAGAAAGACATTGG + Intergenic
1165545627 19:36533066-36533088 TGTCTACAGCAGAAGGAGAATGG - Intergenic
1167700124 19:51038453-51038475 AGAGGAAAGCAGGAGGAGGTTGG - Intergenic
1167808382 19:51806425-51806447 AGACTCCAGCAGAAAGACATTGG - Intronic
1167826560 19:51978824-51978846 AGACTCCAGCAGAAAGACATTGG + Intronic
925780822 2:7380195-7380217 AGACTATACCTGGAGGAGTTGGG + Intergenic
927471295 2:23379571-23379593 GGAGCACAGCAGGAGGAGACAGG - Intergenic
928247835 2:29646584-29646606 AGAGTAAGGCAGGAGGAGAGTGG - Intronic
929683038 2:44010631-44010653 AGACTACAGGAGGGGTCGATGGG + Intergenic
929758403 2:44786732-44786754 ACACTTCAGTAGGAGGAGAAAGG + Intergenic
931026958 2:58120968-58120990 AGACTACTGCAATAGGAGAGAGG - Intronic
931265573 2:60657188-60657210 AGACTCTAGCAGGGGGAAATGGG - Intergenic
932562072 2:72881978-72882000 AGAAGACAGCAGTAGGAGGTGGG - Intergenic
933224171 2:79726377-79726399 AGCCCACAGCAGGAGGTGAGTGG + Intronic
934157899 2:89220185-89220207 AGACCACAGCAGGTGGACACAGG + Intergenic
934209363 2:89962237-89962259 AGACCACAGCAGGTGGACACAGG - Intergenic
937890319 2:126933714-126933736 AGTTTACAGCAGTAGAAGATTGG + Intergenic
937905238 2:127049852-127049874 AAGCCACAGCAGGAGGAGAAGGG + Intronic
938555624 2:132421187-132421209 AGACTTCAGAAAGAGAAGATGGG - Intronic
938687653 2:133756193-133756215 AGACTACAGCAGAGAGAGCTTGG + Intergenic
938929420 2:136073510-136073532 AGACTCCAGCAGAAAGACATTGG - Intergenic
939568276 2:143810573-143810595 TTCCTACAGCAGGAGGAGGTTGG - Intergenic
940795169 2:158070148-158070170 AGACTACAGTAGCAAAAGATTGG - Intronic
940901593 2:159131091-159131113 AGGCCACGGCAGGAAGAGATGGG - Intronic
942517429 2:176768593-176768615 AAACAACAGCAGCAGGAGTTCGG - Intergenic
945828540 2:214754960-214754982 AGACCATAGCAAGAGAAGATGGG + Intronic
946167452 2:217873620-217873642 AGATTTCAGCAGGAGGAGGCTGG + Intronic
946702545 2:222427014-222427036 AAACTATAGCAGGGGGAGCTAGG - Intronic
947253450 2:228134893-228134915 AGACTGCAGGAGTAGGAAATGGG + Intronic
1168905533 20:1400634-1400656 AGACTCCAGCAGAAAGACATTGG + Intergenic
1169672295 20:8115908-8115930 AGGGTACATCAGGATGAGATGGG - Intergenic
1170607367 20:17883988-17884010 AGCCTACAGTGGCAGGAGATGGG + Intergenic
1171474395 20:25396783-25396805 AGACTCCAGCAGAAAGACATTGG - Intergenic
1172361442 20:34315530-34315552 AGAAGACAAAAGGAGGAGATAGG - Intergenic
1172827577 20:37803577-37803599 AGACAACAGCAGGAAGAGACTGG - Intronic
1173332853 20:42089684-42089706 AGACTACAGCAGCAGCAGAATGG + Intronic
1173883014 20:46433112-46433134 AGACAACAGGTGGATGAGATGGG + Intergenic
1174139032 20:48400106-48400128 AGACACCAGCAGGAGGAGAGGGG - Intergenic
1175296598 20:57913106-57913128 AGACTCCAGCAAGAGGAGGCAGG + Intergenic
1175424810 20:58856441-58856463 AGAGTACAGTAGGAGGGGCTTGG + Intronic
1176618753 21:9041432-9041454 AGGCTAGCGCAGGAGGTGATGGG + Intergenic
1179932553 21:44579851-44579873 GGGGCACAGCAGGAGGAGATGGG + Exonic
1180748308 22:18107465-18107487 AGCATACAGCAGGGTGAGATGGG + Intronic
1183061955 22:35341627-35341649 GGGCTGCAGCAGGAGCAGATTGG - Intronic
1183671842 22:39277795-39277817 AGACAACAGCAGGGTGAGACTGG + Intergenic
1184740480 22:46426066-46426088 CGACTCCAGCAGTTGGAGATGGG - Intronic
949374260 3:3369601-3369623 AGACTAGAGTATGAGGAAATTGG - Intergenic
950623693 3:14228511-14228533 AGACTCCAGCAGAAAGACATTGG + Intergenic
950732790 3:14976482-14976504 GGACTACAGCAGGAGGTCAGAGG - Intronic
951550265 3:23870237-23870259 AGACAGCTGCAGGATGAGATGGG + Intronic
951708675 3:25568551-25568573 AGACAATAGCAGGAGGAGAGAGG - Intronic
952472479 3:33671014-33671036 AAACTAGAGCAGCAGGAGATGGG - Intronic
953846381 3:46430328-46430350 AGACTCCAGCAGAAAGACATTGG + Intergenic
954263262 3:49455209-49455231 TGACTTCAGCAGCAGGACATGGG - Intergenic
954693486 3:52408380-52408402 GGAAGACAGGAGGAGGAGATAGG - Intronic
955652987 3:61214445-61214467 AGACTAAAGCAGGAAGAAGTTGG + Intronic
957907029 3:86570219-86570241 AGACCAGAGCAGAAGGAGATTGG + Intergenic
958264971 3:91427331-91427353 AGAGTACAGTAGGAGAAAATTGG + Intergenic
959123716 3:102264784-102264806 ACAATACAGCAGGAGGAGACAGG - Intronic
960259240 3:115546590-115546612 AGACTACAGTGGGAGGATTTGGG + Intergenic
961365789 3:126398420-126398442 AGACTCCAGAAGGAGCAGGTTGG + Intronic
961672195 3:128541455-128541477 AAACTATATCAGGAGGAGAAAGG - Intergenic
961892332 3:130140597-130140619 AGAGTACAGCAGAAGGAGCTGGG + Intergenic
962198279 3:133381146-133381168 CACTTACAGCAGGAGGAGATGGG - Exonic
962613593 3:137102496-137102518 AGAACACAGCAGGAGGACAGCGG - Intergenic
962853883 3:139327595-139327617 AGCCTACAGAAGGAGTAGAAGGG - Intronic
963273136 3:143304912-143304934 AAACACCAGCAGGAGGAGCTAGG - Intronic
963624970 3:147659818-147659840 ATAATACAGGAGGAGGAAATTGG + Intergenic
964383796 3:156126063-156126085 GGATTTGAGCAGGAGGAGATGGG + Intronic
964518408 3:157538131-157538153 AGAATATAGCGGGAGAAGATGGG + Intergenic
965493772 3:169372680-169372702 AGACAACAGCAGAAGCAGCTTGG - Intronic
965556185 3:170020781-170020803 AGACTACAGCAGGCTCAGCTGGG + Intergenic
967190315 3:186979065-186979087 AGACCTCAGCAGCAGGAGCTGGG + Intronic
967576603 3:191102209-191102231 GGACTAAAGAATGAGGAGATAGG + Intergenic
970091505 4:12413457-12413479 ACTCCACAGCAGGAGTAGATTGG - Intergenic
971641159 4:29134935-29134957 AAACTACAGCAAGAGCAGTTTGG + Intergenic
973734109 4:53853336-53853358 AGGCTACAGGAGGGGGATATGGG + Intronic
975597345 4:76061794-76061816 AGACTAAAGAAGTAGGAGTTAGG - Intronic
975737442 4:77394862-77394884 AGACTCCAGCAGAAAGACATTGG - Intronic
976028253 4:80718362-80718384 AAACTACAGAAGTAGGAGAAAGG + Intronic
976311011 4:83613573-83613595 AAACTATAGCAAGAAGAGATGGG - Intergenic
977262310 4:94812659-94812681 AGACTAGAGACGGAGGAGAGAGG + Intronic
977616867 4:99096638-99096660 AGACTAAACCAGGAAGAAATTGG - Intergenic
977646337 4:99416872-99416894 AGACTATAGAAGGAATAGATTGG - Intronic
979029775 4:115628373-115628395 AGACTACAGACGGAGTAGTTTGG - Intergenic
979557995 4:122072783-122072805 AGACTATAGGAGGAGCAGTTTGG + Intergenic
979834138 4:125340486-125340508 AGACTGAGGCAGGAGGAGAATGG - Intronic
981496003 4:145393392-145393414 AGAATACAGCAGAAGGACACAGG + Intergenic
982574707 4:157095350-157095372 AAACTACAGGAAGAGTAGATAGG + Intronic
982742792 4:159075063-159075085 AGAGTACATCAGCAGGAGATGGG - Intergenic
983266503 4:165513374-165513396 AGACTTGAGAAGGGGGAGATAGG - Intergenic
983443966 4:167824959-167824981 AGCTTACAGCCGGAGAAGATAGG + Intergenic
985029533 4:185775073-185775095 AGAATACAGCAGGAGCATCTGGG - Intronic
986918929 5:12661570-12661592 AGACTAGAGGAGGAGGTAATTGG + Intergenic
987580079 5:19778802-19778824 AGATATCAGCATGAGGAGATGGG - Intronic
987949100 5:24653176-24653198 AGACTCCAGCAGAAAGACATTGG + Intergenic
988101411 5:26683795-26683817 AAACTACTGCAGGAGGAAAAGGG + Intergenic
988452154 5:31354121-31354143 AGAAGAGAGGAGGAGGAGATAGG - Intergenic
989079273 5:37599840-37599862 AGAGTACAGCAGGACGATCTCGG - Intronic
992040663 5:72827659-72827681 AGGCAACTGGAGGAGGAGATTGG + Intronic
994847096 5:105003268-105003290 AGACTAAACCAGGAGGAAGTTGG - Intergenic
998379586 5:141714654-141714676 AAAGTACAGCAGGAGAAGACAGG - Intergenic
999322008 5:150621332-150621354 AGACTTCAGAAGGATGAAATGGG + Intronic
1000125666 5:158241275-158241297 AGAATATAGCAGAAGGAGTTGGG + Intergenic
1002073318 5:176693559-176693581 AGACTACAGCAAGACGGAATCGG - Intergenic
1002740229 5:181429949-181429971 GGACCAAAGCAGGAGGAGAGGGG + Intergenic
1003049957 6:2771139-2771161 AGTCCACAGCAGGAGGAGGTGGG - Intronic
1003873304 6:10417845-10417867 AGACTGCCGCAGGAGGAGGAAGG - Intronic
1004580544 6:16946955-16946977 AGACTCAAGAAGGAAGAGATGGG + Intergenic
1005100183 6:22163942-22163964 AGACAGGAGCAGGAAGAGATTGG - Intergenic
1006077058 6:31540455-31540477 AGACAGCAGCTGGGGGAGATGGG - Exonic
1006365054 6:33610374-33610396 AGGCTAGAGCAGTAGGGGATGGG - Intergenic
1006403434 6:33830914-33830936 GGCCTACAGCAGGAGGGGGTCGG + Intergenic
1006689685 6:35871590-35871612 AGACTAAAGAAGGGGGAAATGGG - Intronic
1007335997 6:41155626-41155648 AGACTACAGCAGCTGGGGATGGG + Intergenic
1007747082 6:44049839-44049861 AGACTAAGGCTGGAAGAGATAGG + Intergenic
1008990412 6:57595330-57595352 AGAGTACAGTAGGAGAAAATTGG - Intronic
1009178987 6:60493877-60493899 AGAGTACAGTAGGAGAAAATTGG - Intergenic
1011665895 6:89633125-89633147 AGACTACAGAAGAATGAGAAGGG + Exonic
1011961893 6:93101041-93101063 AGACTGGAGCAGAGGGAGATAGG + Intergenic
1012553126 6:100482380-100482402 AGATTCCAGCAGGAACAGATGGG - Intergenic
1012553538 6:100485997-100486019 AGGCCACAGCAGGCTGAGATGGG - Intergenic
1013840980 6:114393510-114393532 AGGCAAGAGGAGGAGGAGATGGG - Intergenic
1014725766 6:124970074-124970096 AGAAGACAGCAGGAGGAGTGGGG + Intronic
1014747293 6:125214772-125214794 AAACTACAGCAGCATGAAATTGG - Intronic
1015230306 6:130907617-130907639 AGTCTACAGGAAGAGGAAATGGG + Intronic
1015347103 6:132173444-132173466 AGATTACAGCAAAAGGAAATTGG + Intergenic
1015851135 6:137573926-137573948 GGGCCACAGGAGGAGGAGATTGG + Intergenic
1016785080 6:148002445-148002467 TCACAACAGCAGGAGGAGCTAGG - Intergenic
1017328897 6:153172631-153172653 AGACTGCAGCTGCAGCAGATAGG + Intergenic
1017659476 6:156659631-156659653 AGGCTACAGCAGGCTGGGATTGG - Intergenic
1018479286 6:164173825-164173847 AACCTAGAGCAGGTGGAGATTGG + Intergenic
1019245342 6:170705549-170705571 GGACCAAAGCAGGAGGAGAGGGG + Intergenic
1019729567 7:2622720-2622742 AGGCTGGGGCAGGAGGAGATGGG - Intergenic
1020044492 7:5031127-5031149 AGACTTCATCATGAGGAGGTAGG - Intronic
1020289850 7:6715149-6715171 AGACTTCATCATGAGGAGGTAGG - Intergenic
1021090888 7:16481374-16481396 AGGGGACAGTAGGAGGAGATGGG - Intronic
1022484191 7:30765472-30765494 AGGCTCCAGTAGGAGGAGATGGG - Intronic
1023171528 7:37394367-37394389 AGACTAGAGAACGAGGAGACAGG + Intronic
1023825856 7:44008227-44008249 AGACTTCATCATGAGGAGGTAGG + Intronic
1023939570 7:44761037-44761059 AGACCACAGCAGCAGAAGTTGGG + Intronic
1024250560 7:47502802-47502824 AGAGTGCAGCAAGAGGAGAGAGG - Intronic
1025776621 7:64566823-64566845 AGATTATAGAAGCAGGAGATGGG - Intergenic
1025790445 7:64682795-64682817 TGAATAAAGCTGGAGGAGATGGG - Intronic
1026089426 7:67287078-67287100 AGACTTCATCATGAGGAGGTAGG + Intergenic
1026724855 7:72863422-72863444 AGACTTCATCATGAGGAGGTAGG - Intergenic
1027119020 7:75502396-75502418 AGACTTCATCATGAGGAGGTAGG + Intergenic
1027272805 7:76533212-76533234 AGACTTCATCATGAGGAGGTAGG - Intergenic
1027326254 7:77052297-77052319 AGACTTCATCATGAGGAGGTAGG - Intergenic
1028111533 7:86948166-86948188 AGACCACAACAGCAGGAGAGAGG - Intronic
1028424288 7:90669118-90669140 AGAATGGAGGAGGAGGAGATGGG - Intronic
1029718477 7:102347621-102347643 AGACTTCATCATGAGGAGGTAGG - Intergenic
1029754139 7:102561634-102561656 AGACTTCATCATGAGGAGGTAGG + Intronic
1029772089 7:102660724-102660746 AGACTTCATCATGAGGAGGTAGG + Intronic
1030520603 7:110593584-110593606 AGCATACAGCAGAAGGAGCTGGG + Intergenic
1031258753 7:119489453-119489475 TGACTAAAGCTGGAGCAGATGGG + Intergenic
1032467534 7:132155674-132155696 CGACCACAGCGGGAGGAGTTGGG - Intronic
1032544175 7:132728057-132728079 AGACTAAAGCAGCAGAAGTTTGG + Exonic
1034054094 7:148016213-148016235 AGACTTCCCCAGGAGGGGATGGG - Intronic
1034351962 7:150422007-150422029 AGTCGACTGCAGGAGGAGAGAGG + Intergenic
1035227774 7:157443090-157443112 AGCGTACAGCAGGAGGTGAGTGG - Intergenic
1035335184 7:158123454-158123476 AGACTCCTGCAGGAAGAGAGTGG - Intronic
1035502785 8:102653-102675 GGACCAAAGCAGGAGGAGAGGGG - Intergenic
1035613770 8:987458-987480 AGACCACAGGAGGAAGAGACAGG + Intergenic
1035619459 8:1026471-1026493 AGATCACAGCAGGAGCAGGTCGG - Intergenic
1037691534 8:21185305-21185327 AGAGGAGAGCCGGAGGAGATTGG + Intergenic
1037890790 8:22622832-22622854 AGCCTTCTGCAGGAGGAGGTAGG - Intronic
1037934927 8:22909157-22909179 AGCCGACACCAGGGGGAGATAGG - Intronic
1038004815 8:23420836-23420858 AGACTCCAGCAGAAAGACATTGG + Intronic
1038796817 8:30717444-30717466 AGGCTGCAGCAGGAGGTGAGTGG + Intronic
1040412703 8:47170443-47170465 AGATTAAATCAGGAAGAGATTGG - Intergenic
1040869969 8:52090407-52090429 TGACTACAGCATTTGGAGATAGG - Intergenic
1040985996 8:53294930-53294952 AGAAGTCAGCAGGAGGAGAGGGG - Intergenic
1041222529 8:55665748-55665770 AGAATGCATCAGCAGGAGATTGG - Intergenic
1041730119 8:61054235-61054257 AGGCTGCTGCAGGAGGAGATAGG - Intergenic
1041836345 8:62220185-62220207 AGATGACAGCAGGCAGAGATGGG + Intergenic
1042201433 8:66282474-66282496 AGACAACCTCAGGAGGAGAAAGG - Intergenic
1043926441 8:86042209-86042231 AGACTACAGCAGAAACAGGTGGG + Intronic
1044861160 8:96525294-96525316 AGACTACAGCAGCACCAAATGGG - Intronic
1044961731 8:97537973-97537995 AGTTTACAGCAGGATGAGAAAGG - Intergenic
1047086578 8:121523694-121523716 TGACTGCAGAAGTAGGAGATAGG - Intergenic
1047191316 8:122681481-122681503 AAAATGCAGCCGGAGGAGATGGG - Intergenic
1047340136 8:123973141-123973163 AAATTTCAGCAGGAAGAGATGGG + Intronic
1047704118 8:127480565-127480587 AGACAACAGCAGCAGCAGAAAGG - Intergenic
1048415419 8:134222984-134223006 AGAGTACTGCAGTAGGAGAAAGG + Intergenic
1049298366 8:141855784-141855806 AGCCAACAGCAGGAGGAGGGCGG + Intergenic
1049310402 8:141931145-141931167 AGACTGCAGCTGGAGCAGGTAGG + Intergenic
1049537497 8:143189102-143189124 AGACCACAGCAGGGAGAGGTAGG - Intergenic
1050633090 9:7581280-7581302 ACTCAACAGCAGGAGGAGAAGGG + Intergenic
1050979115 9:11986680-11986702 AGACTACCGAAGGGGGAGAGAGG - Intergenic
1051364102 9:16308780-16308802 AGACCACAGCTGGAGGGGATGGG - Intergenic
1051706026 9:19880741-19880763 AGGCTATAGGAGGAAGAGATTGG + Intergenic
1053718741 9:40923672-40923694 AGACTACAGCAGGAGTGTTTTGG - Intergenic
1054800886 9:69347201-69347223 AGACCACAGCAGAAGGAGGCTGG + Intronic
1055812830 9:80169958-80169980 AGACTTGAGGAGAAGGAGATGGG + Intergenic
1057076747 9:92141966-92141988 AGAATGCAGCAACAGGAGATGGG - Intergenic
1058283947 9:103152886-103152908 AGACTGCAGCAAGATGAGCTGGG + Intergenic
1060514504 9:124257679-124257701 AGTCTAGAGCCGGAGAAGATGGG + Intronic
1061675165 9:132211502-132211524 AGGCTACAGAAGGAGGTGAGAGG - Intronic
1203495544 Un_GL000224v1:147904-147926 AGACCACAGCAGGAGGATTGTGG - Intergenic
1203508169 Un_KI270741v1:89827-89849 AGACCACAGCAGGAGGATTGTGG - Intergenic
1203605538 Un_KI270748v1:54757-54779 GGACCAAAGCAGGAGGAGAGGGG + Intergenic
1187202186 X:17145722-17145744 AGATTATAGCAGGATGAGAGTGG - Intronic
1187243162 X:17531449-17531471 AGACAGCTGCAGGAGAAGATGGG - Intronic
1187553196 X:20326511-20326533 ACACTACAGCTGGAGAACATAGG - Intergenic
1191103748 X:56759700-56759722 AGGCTGAAGCAGGAGGAGAGAGG + Intergenic
1191108651 X:56788430-56788452 AGACTGAAGCAGGATGAGAGAGG + Intergenic
1191692997 X:63960020-63960042 AGAAAGCAGCAGGAAGAGATGGG + Intergenic
1191884049 X:65871809-65871831 AGATTAAAGCAGGAAGAAATAGG - Intergenic
1192830918 X:74750141-74750163 AGAATTCAGGAGGAGGAAATAGG + Intronic
1192917766 X:75672330-75672352 AGACTACAGAAGAATGAGAAAGG + Intergenic
1193021249 X:76796219-76796241 AGAAGACTGCAGTAGGAGATGGG + Intergenic
1194310417 X:92299512-92299534 AGACTAAACCAGGAAGAAATTGG - Intronic
1196195297 X:112832938-112832960 AGGCAACAGCAGGAGGAGGAGGG - Intronic
1196786056 X:119422372-119422394 AGACTACTGCTTGGGGAGATGGG - Intronic
1197583241 X:128311053-128311075 TGACTAGAGCTGGAGCAGATGGG + Intergenic
1197968794 X:132093579-132093601 AGAGTACAGCAGGTGGAGAGAGG - Intronic
1199252420 X:145678607-145678629 AGAGTTCTGAAGGAGGAGATAGG + Intergenic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic
1200618704 Y:5413798-5413820 AGACTAAACCAGGAAGAAATTGG - Intronic
1201594595 Y:15653620-15653642 AGAAAAGGGCAGGAGGAGATGGG + Intergenic
1201742191 Y:17336239-17336261 AGACTCCAGCAGAAAGACATTGG + Intergenic
1202336894 Y:23821289-23821311 AGACTGTAGCAGAAGGACATTGG - Intergenic
1202533871 Y:25848782-25848804 AGACTGTAGCAGAAGGACATTGG + Intergenic