ID: 1094708518

View in Genome Browser
Species Human (GRCh38)
Location 12:32938093-32938115
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094708518_1094708522 2 Left 1094708518 12:32938093-32938115 CCTTGTGTTTGGAAAATATCTAC No data
Right 1094708522 12:32938118-32938140 CTGCAGAATGGGGTGTGTCCTGG No data
1094708518_1094708519 -10 Left 1094708518 12:32938093-32938115 CCTTGTGTTTGGAAAATATCTAC No data
Right 1094708519 12:32938106-32938128 AAATATCTACAGCTGCAGAATGG No data
1094708518_1094708521 -8 Left 1094708518 12:32938093-32938115 CCTTGTGTTTGGAAAATATCTAC No data
Right 1094708521 12:32938108-32938130 ATATCTACAGCTGCAGAATGGGG No data
1094708518_1094708520 -9 Left 1094708518 12:32938093-32938115 CCTTGTGTTTGGAAAATATCTAC No data
Right 1094708520 12:32938107-32938129 AATATCTACAGCTGCAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094708518 Original CRISPR GTAGATATTTTCCAAACACA AGG (reversed) Intergenic
No off target data available for this crispr