ID: 1094708519

View in Genome Browser
Species Human (GRCh38)
Location 12:32938106-32938128
Sequence AAATATCTACAGCTGCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094708517_1094708519 -9 Left 1094708517 12:32938092-32938114 CCCTTGTGTTTGGAAAATATCTA No data
Right 1094708519 12:32938106-32938128 AAATATCTACAGCTGCAGAATGG No data
1094708518_1094708519 -10 Left 1094708518 12:32938093-32938115 CCTTGTGTTTGGAAAATATCTAC No data
Right 1094708519 12:32938106-32938128 AAATATCTACAGCTGCAGAATGG No data
1094708516_1094708519 0 Left 1094708516 12:32938083-32938105 CCATTGTGTCCCTTGTGTTTGGA No data
Right 1094708519 12:32938106-32938128 AAATATCTACAGCTGCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094708519 Original CRISPR AAATATCTACAGCTGCAGAA TGG Intergenic
No off target data available for this crispr