ID: 1094709558

View in Genome Browser
Species Human (GRCh38)
Location 12:32947876-32947898
Sequence CTAGGTTACAGTGTGATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094709556_1094709558 16 Left 1094709556 12:32947837-32947859 CCTAAAGCAGTTATAACACATAT No data
Right 1094709558 12:32947876-32947898 CTAGGTTACAGTGTGATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094709558 Original CRISPR CTAGGTTACAGTGTGATGCA TGG Intergenic
No off target data available for this crispr