ID: 1094712007 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:32973759-32973781 |
Sequence | CTTTGGTCAGAATTTCGGGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1094712007_1094712018 | 26 | Left | 1094712007 | 12:32973759-32973781 | CCCTCCCGAAATTCTGACCAAAG | No data | ||
Right | 1094712018 | 12:32973808-32973830 | TTTTTAAATAATGAAGTTTTGGG | No data | ||||
1094712007_1094712017 | 25 | Left | 1094712007 | 12:32973759-32973781 | CCCTCCCGAAATTCTGACCAAAG | No data | ||
Right | 1094712017 | 12:32973807-32973829 | TTTTTTAAATAATGAAGTTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1094712007 | Original CRISPR | CTTTGGTCAGAATTTCGGGA GGG (reversed) | Intergenic | ||