ID: 1094712007

View in Genome Browser
Species Human (GRCh38)
Location 12:32973759-32973781
Sequence CTTTGGTCAGAATTTCGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094712007_1094712017 25 Left 1094712007 12:32973759-32973781 CCCTCCCGAAATTCTGACCAAAG No data
Right 1094712017 12:32973807-32973829 TTTTTTAAATAATGAAGTTTTGG No data
1094712007_1094712018 26 Left 1094712007 12:32973759-32973781 CCCTCCCGAAATTCTGACCAAAG No data
Right 1094712018 12:32973808-32973830 TTTTTAAATAATGAAGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094712007 Original CRISPR CTTTGGTCAGAATTTCGGGA GGG (reversed) Intergenic
No off target data available for this crispr