ID: 1094712018

View in Genome Browser
Species Human (GRCh38)
Location 12:32973808-32973830
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094712016_1094712018 9 Left 1094712016 12:32973776-32973798 CCAAAGGGAACTTGGGGATAATA No data
Right 1094712018 12:32973808-32973830 TTTTTAAATAATGAAGTTTTGGG No data
1094712008_1094712018 25 Left 1094712008 12:32973760-32973782 CCTCCCGAAATTCTGACCAAAGG No data
Right 1094712018 12:32973808-32973830 TTTTTAAATAATGAAGTTTTGGG No data
1094712006_1094712018 27 Left 1094712006 12:32973758-32973780 CCCCTCCCGAAATTCTGACCAAA No data
Right 1094712018 12:32973808-32973830 TTTTTAAATAATGAAGTTTTGGG No data
1094712007_1094712018 26 Left 1094712007 12:32973759-32973781 CCCTCCCGAAATTCTGACCAAAG No data
Right 1094712018 12:32973808-32973830 TTTTTAAATAATGAAGTTTTGGG No data
1094712012_1094712018 21 Left 1094712012 12:32973764-32973786 CCGAAATTCTGACCAAAGGGAAC No data
Right 1094712018 12:32973808-32973830 TTTTTAAATAATGAAGTTTTGGG No data
1094712011_1094712018 22 Left 1094712011 12:32973763-32973785 CCCGAAATTCTGACCAAAGGGAA No data
Right 1094712018 12:32973808-32973830 TTTTTAAATAATGAAGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094712018 Original CRISPR TTTTTAAATAATGAAGTTTT GGG Intergenic