ID: 1094713235

View in Genome Browser
Species Human (GRCh38)
Location 12:32986180-32986202
Sequence GTCCCATGGCGTCACGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 53}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094713228_1094713235 2 Left 1094713228 12:32986155-32986177 CCCACCGGGAGGGGGCCAAGTAT 0: 1
1: 1
2: 1
3: 6
4: 45
Right 1094713235 12:32986180-32986202 GTCCCATGGCGTCACGGGAAAGG 0: 1
1: 0
2: 2
3: 8
4: 53
1094713230_1094713235 -2 Left 1094713230 12:32986159-32986181 CCGGGAGGGGGCCAAGTATGTGT 0: 1
1: 0
2: 1
3: 9
4: 87
Right 1094713235 12:32986180-32986202 GTCCCATGGCGTCACGGGAAAGG 0: 1
1: 0
2: 2
3: 8
4: 53
1094713221_1094713235 23 Left 1094713221 12:32986134-32986156 CCTGCAAACAAGTGGAAATTGCC 0: 1
1: 4
2: 4
3: 12
4: 151
Right 1094713235 12:32986180-32986202 GTCCCATGGCGTCACGGGAAAGG 0: 1
1: 0
2: 2
3: 8
4: 53
1094713229_1094713235 1 Left 1094713229 12:32986156-32986178 CCACCGGGAGGGGGCCAAGTATG 0: 1
1: 1
2: 2
3: 6
4: 59
Right 1094713235 12:32986180-32986202 GTCCCATGGCGTCACGGGAAAGG 0: 1
1: 0
2: 2
3: 8
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094713235 Original CRISPR GTCCCATGGCGTCACGGGAA AGG Intergenic
901866304 1:12109300-12109322 GTCTCATGGCCACTCGGGAAAGG + Intronic
909070382 1:70986395-70986417 CTGCCATGGCGTTACAGGAAAGG - Intronic
916314958 1:163438753-163438775 GTCCCATGTCAACAAGGGAAGGG - Intergenic
920874205 1:209819054-209819076 GTCCCATAGGGTCAGGTGAATGG - Intergenic
922205093 1:223439286-223439308 GTCCCATGGCCACACCTGAATGG + Intergenic
1067474716 10:46557605-46557627 GGCCCCCGGCGTCACGGGACCGG - Intergenic
1067720344 10:48723328-48723350 GTCCCATGGCCTCACTGAAATGG + Intronic
1068757020 10:60667692-60667714 GTCCCATGTACTCACTGGAAAGG - Intronic
1073115584 10:101089818-101089840 GCCCCATGGCCTCTTGGGAAAGG + Exonic
1073695372 10:105860571-105860593 GTTCCATTGCTTCACGGGGAAGG - Intergenic
1076710878 10:132333459-132333481 GTCACCTGGAGACACGGGAAAGG - Exonic
1077334889 11:1998820-1998842 TTCCCATGGCCCCACCGGAAAGG + Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1202817872 11_KI270721v1_random:54002-54024 TTCCCATGGCCCCACCGGAAAGG + Intergenic
1094713235 12:32986180-32986202 GTCCCATGGCGTCACGGGAAAGG + Intergenic
1120741129 14:88110168-88110190 GACACATGGCATCATGGGAATGG - Intergenic
1129727374 15:77908470-77908492 GTCCCATGGCTTGCAGGGAAGGG - Intergenic
1129840505 15:78740516-78740538 GTCCCATGGCTTGCAGGGAAGGG + Intergenic
1139877266 16:70156377-70156399 GTCCCCTGGTGTCACTGCAATGG - Intronic
1143927284 17:10383105-10383127 GTCCCAGGGCATCATGGGAAGGG + Intergenic
1143975866 17:10829182-10829204 GCCCCATGTCTTCACGGAAACGG - Intronic
1145941248 17:28744379-28744401 GCCCCGTGACGTCACGGGGAGGG + Intronic
1147266417 17:39237409-39237431 CTCCCGTGGCGTCAGGGGAGGGG + Intergenic
1152770301 17:82163443-82163465 GTGCCATGGCCTCACGGGAAAGG - Intronic
1154105552 18:11519484-11519506 GCCCCATGGCCACCCGGGAAGGG - Intergenic
1158653519 18:59308397-59308419 CTCCCATGGCATAACGGGAGAGG - Intronic
1161548411 19:4896562-4896584 GTCCCATGGGGAGAAGGGAAGGG - Intronic
1165100460 19:33435794-33435816 CTCCCATGGCGTCCCTGGATTGG + Intronic
1166051234 19:40261582-40261604 GTCCCATGGTGAAAGGGGAAGGG - Intronic
1167271719 19:48509976-48509998 ATCCCATGGTGTCCCGGGAAAGG - Intronic
926543982 2:14215939-14215961 GTCCCATGACTTCAGGGAAATGG - Intergenic
929945778 2:46370819-46370841 GTCGCATGGATTCAAGGGAACGG - Intronic
930205681 2:48584818-48584840 GTCCCATGGCCTCCAGGGTACGG - Intronic
932605512 2:73163082-73163104 GCCCCACGGGGTCAGGGGAAGGG + Intergenic
934935321 2:98461050-98461072 ACCCCATGAGGTCACGGGAAGGG - Intronic
942678852 2:178455555-178455577 GTCCCAGGGCATCAGGAGAAAGG + Intronic
944647762 2:201796716-201796738 GACCCATTGTGTCAGGGGAAAGG + Intronic
948948742 2:241235460-241235482 GTGACATGGCCTCCCGGGAAAGG + Intronic
1171168998 20:22998867-22998889 TTCCCACGGCTTCTCGGGAATGG - Intergenic
1175991007 20:62789120-62789142 CTCCCAGGGGGCCACGGGAAGGG + Intergenic
1176081638 20:63276322-63276344 GTGCCATGGCGTCACTAGAGTGG - Intronic
1182080062 22:27522530-27522552 GTCCCGTGGGGACTCGGGAAGGG + Intergenic
1183665054 22:39242358-39242380 GTGCCAGGGCGTCCTGGGAACGG - Intronic
1185192839 22:49449804-49449826 TTCCCATGACTTCACGGGAGAGG + Intronic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
967949413 3:194829379-194829401 GGCCCAAGGCCTGACGGGAATGG - Intergenic
977444148 4:97107538-97107560 GTCCCAAGGAATCAAGGGAAGGG + Intergenic
981516983 4:145619906-145619928 GTCACATGGCGTGCCGGGCAGGG + Intronic
982514737 4:156330867-156330889 GTCCCATTGCGACACTGGATTGG + Intergenic
993519715 5:88885293-88885315 GTCCCAAGGCTTCACTTGAAAGG + Intronic
1013590962 6:111619344-111619366 GTCCCATGGCGTCAGGGTCTCGG - Intergenic
1018017651 6:159727057-159727079 GCCCCAGGGCATCACGGGAAGGG - Exonic
1038097831 8:24335557-24335579 TTCCCTTGCCATCACGGGAAGGG + Exonic
1047063236 8:121251036-121251058 ATCCCATGGCTTCCCTGGAATGG - Intergenic
1052927868 9:34032442-34032464 GTCCCAAGGCTTCACAGGAAAGG + Intronic
1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG + Intergenic
1060540453 9:124426524-124426546 TTCTCAGGGCATCACGGGAAGGG + Intergenic
1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG + Exonic
1185838490 X:3367490-3367512 ATCCTACGGCGTCATGGGAAAGG + Intergenic
1187401501 X:18964328-18964350 GTCCCATGGAGTGAAGGAAAGGG - Intronic
1192180003 X:68910499-68910521 GTCTCATGGGGTGATGGGAAAGG + Intergenic
1196306338 X:114107651-114107673 GTCCCATGGTGTCAGCGTAATGG - Intergenic
1196434822 X:115665236-115665258 GTCCCACAGCGCCACAGGAAAGG + Intergenic
1201237271 Y:11923406-11923428 ATCCTATGGCATCATGGGAAAGG - Intergenic