ID: 1094714136

View in Genome Browser
Species Human (GRCh38)
Location 12:32994864-32994886
Sequence ATGGTCATCTGTGGAACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094714136_1094714140 3 Left 1094714136 12:32994864-32994886 CCACCAGTTCCACAGATGACCAT No data
Right 1094714140 12:32994890-32994912 CATTCCACAGACGACCCACTTGG No data
1094714136_1094714144 15 Left 1094714136 12:32994864-32994886 CCACCAGTTCCACAGATGACCAT No data
Right 1094714144 12:32994902-32994924 GACCCACTTGGGAATCAGCTGGG No data
1094714136_1094714143 14 Left 1094714136 12:32994864-32994886 CCACCAGTTCCACAGATGACCAT No data
Right 1094714143 12:32994901-32994923 CGACCCACTTGGGAATCAGCTGG No data
1094714136_1094714145 16 Left 1094714136 12:32994864-32994886 CCACCAGTTCCACAGATGACCAT No data
Right 1094714145 12:32994903-32994925 ACCCACTTGGGAATCAGCTGGGG No data
1094714136_1094714141 4 Left 1094714136 12:32994864-32994886 CCACCAGTTCCACAGATGACCAT No data
Right 1094714141 12:32994891-32994913 ATTCCACAGACGACCCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094714136 Original CRISPR ATGGTCATCTGTGGAACTGG TGG (reversed) Intergenic