ID: 1094714137

View in Genome Browser
Species Human (GRCh38)
Location 12:32994867-32994889
Sequence AGTATGGTCATCTGTGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094714137_1094714144 12 Left 1094714137 12:32994867-32994889 CCAGTTCCACAGATGACCATACT No data
Right 1094714144 12:32994902-32994924 GACCCACTTGGGAATCAGCTGGG No data
1094714137_1094714145 13 Left 1094714137 12:32994867-32994889 CCAGTTCCACAGATGACCATACT No data
Right 1094714145 12:32994903-32994925 ACCCACTTGGGAATCAGCTGGGG No data
1094714137_1094714141 1 Left 1094714137 12:32994867-32994889 CCAGTTCCACAGATGACCATACT No data
Right 1094714141 12:32994891-32994913 ATTCCACAGACGACCCACTTGGG No data
1094714137_1094714143 11 Left 1094714137 12:32994867-32994889 CCAGTTCCACAGATGACCATACT No data
Right 1094714143 12:32994901-32994923 CGACCCACTTGGGAATCAGCTGG No data
1094714137_1094714140 0 Left 1094714137 12:32994867-32994889 CCAGTTCCACAGATGACCATACT No data
Right 1094714140 12:32994890-32994912 CATTCCACAGACGACCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094714137 Original CRISPR AGTATGGTCATCTGTGGAAC TGG (reversed) Intergenic
No off target data available for this crispr