ID: 1094714139

View in Genome Browser
Species Human (GRCh38)
Location 12:32994883-32994905
Sequence GGTCGTCTGTGGAATGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094714139_1094714143 -5 Left 1094714139 12:32994883-32994905 CCATACTCATTCCACAGACGACC No data
Right 1094714143 12:32994901-32994923 CGACCCACTTGGGAATCAGCTGG No data
1094714139_1094714144 -4 Left 1094714139 12:32994883-32994905 CCATACTCATTCCACAGACGACC No data
Right 1094714144 12:32994902-32994924 GACCCACTTGGGAATCAGCTGGG No data
1094714139_1094714149 30 Left 1094714139 12:32994883-32994905 CCATACTCATTCCACAGACGACC No data
Right 1094714149 12:32994936-32994958 AAACAGTTCCTGAGCTGTGATGG No data
1094714139_1094714145 -3 Left 1094714139 12:32994883-32994905 CCATACTCATTCCACAGACGACC No data
Right 1094714145 12:32994903-32994925 ACCCACTTGGGAATCAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094714139 Original CRISPR GGTCGTCTGTGGAATGAGTA TGG (reversed) Intergenic
No off target data available for this crispr