ID: 1094714140 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:32994890-32994912 |
Sequence | CATTCCACAGACGACCCACT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1094714136_1094714140 | 3 | Left | 1094714136 | 12:32994864-32994886 | CCACCAGTTCCACAGATGACCAT | No data | ||
Right | 1094714140 | 12:32994890-32994912 | CATTCCACAGACGACCCACTTGG | No data | ||||
1094714138_1094714140 | -6 | Left | 1094714138 | 12:32994873-32994895 | CCACAGATGACCATACTCATTCC | No data | ||
Right | 1094714140 | 12:32994890-32994912 | CATTCCACAGACGACCCACTTGG | No data | ||||
1094714137_1094714140 | 0 | Left | 1094714137 | 12:32994867-32994889 | CCAGTTCCACAGATGACCATACT | No data | ||
Right | 1094714140 | 12:32994890-32994912 | CATTCCACAGACGACCCACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1094714140 | Original CRISPR | CATTCCACAGACGACCCACT TGG | Intergenic | ||