ID: 1094714141

View in Genome Browser
Species Human (GRCh38)
Location 12:32994891-32994913
Sequence ATTCCACAGACGACCCACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094714136_1094714141 4 Left 1094714136 12:32994864-32994886 CCACCAGTTCCACAGATGACCAT No data
Right 1094714141 12:32994891-32994913 ATTCCACAGACGACCCACTTGGG No data
1094714138_1094714141 -5 Left 1094714138 12:32994873-32994895 CCACAGATGACCATACTCATTCC No data
Right 1094714141 12:32994891-32994913 ATTCCACAGACGACCCACTTGGG No data
1094714137_1094714141 1 Left 1094714137 12:32994867-32994889 CCAGTTCCACAGATGACCATACT No data
Right 1094714141 12:32994891-32994913 ATTCCACAGACGACCCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094714141 Original CRISPR ATTCCACAGACGACCCACTT GGG Intergenic