ID: 1094714589

View in Genome Browser
Species Human (GRCh38)
Location 12:32999979-33000001
Sequence ATGGTTGAGGCCTCTTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094714582_1094714589 15 Left 1094714582 12:32999941-32999963 CCTTAGCACTACTGCCATTCTGG No data
Right 1094714589 12:32999979-33000001 ATGGTTGAGGCCTCTTTTGTAGG No data
1094714587_1094714589 -9 Left 1094714587 12:32999965-32999987 CCAGATAATTCTTTATGGTTGAG No data
Right 1094714589 12:32999979-33000001 ATGGTTGAGGCCTCTTTTGTAGG No data
1094714585_1094714589 1 Left 1094714585 12:32999955-32999977 CCATTCTGGGCCAGATAATTCTT No data
Right 1094714589 12:32999979-33000001 ATGGTTGAGGCCTCTTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094714589 Original CRISPR ATGGTTGAGGCCTCTTTTGT AGG Intergenic
No off target data available for this crispr