ID: 1094714704

View in Genome Browser
Species Human (GRCh38)
Location 12:33001187-33001209
Sequence ATCAAGGCCGGCAGAACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094714704_1094714706 -8 Left 1094714704 12:33001187-33001209 CCTTGTGTTCTGCCGGCCTTGAT No data
Right 1094714706 12:33001202-33001224 GCCTTGATCTCCCAAAGTGCTGG 0: 75
1: 3859
2: 65245
3: 180296
4: 223677
1094714704_1094714708 -7 Left 1094714704 12:33001187-33001209 CCTTGTGTTCTGCCGGCCTTGAT No data
Right 1094714708 12:33001203-33001225 CCTTGATCTCCCAAAGTGCTGGG 0: 138
1: 6186
2: 101384
3: 225002
4: 238582
1094714704_1094714709 1 Left 1094714704 12:33001187-33001209 CCTTGTGTTCTGCCGGCCTTGAT No data
Right 1094714709 12:33001211-33001233 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
1094714704_1094714712 20 Left 1094714704 12:33001187-33001209 CCTTGTGTTCTGCCGGCCTTGAT No data
Right 1094714712 12:33001230-33001252 CAGGTGTGAGCCACCACGCCTGG 0: 4365
1: 30837
2: 97432
3: 166071
4: 217545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094714704 Original CRISPR ATCAAGGCCGGCAGAACACA AGG (reversed) Intergenic
No off target data available for this crispr