ID: 1094723543

View in Genome Browser
Species Human (GRCh38)
Location 12:33089565-33089587
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094723540_1094723543 -3 Left 1094723540 12:33089545-33089567 CCAGTATTGACAGAGGGCTTATC No data
Right 1094723543 12:33089565-33089587 ATCTGTAATACGGAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094723543 Original CRISPR ATCTGTAATACGGAGCTGGA AGG Intergenic
No off target data available for this crispr