ID: 1094728615

View in Genome Browser
Species Human (GRCh38)
Location 12:33148541-33148563
Sequence ATGAAGAAACAGATAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094728613_1094728615 18 Left 1094728613 12:33148500-33148522 CCTTAAGAGGTAGTTACTGTATT No data
Right 1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094728615 Original CRISPR ATGAAGAAACAGATAGAGAA AGG Intergenic
No off target data available for this crispr