ID: 1094733102

View in Genome Browser
Species Human (GRCh38)
Location 12:33200629-33200651
Sequence GCAGCCAGGAAGTTTGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094733102_1094733104 -5 Left 1094733102 12:33200629-33200651 CCAAGTTCAAACTTCCTGGCTGC No data
Right 1094733104 12:33200647-33200669 GCTGCTTTGTTTACACTGTGAGG 0: 10
1: 236
2: 552
3: 440
4: 368
1094733102_1094733106 -3 Left 1094733102 12:33200629-33200651 CCAAGTTCAAACTTCCTGGCTGC No data
Right 1094733106 12:33200649-33200671 TGCTTTGTTTACACTGTGAGGGG 0: 15
1: 465
2: 418
3: 219
4: 297
1094733102_1094733105 -4 Left 1094733102 12:33200629-33200651 CCAAGTTCAAACTTCCTGGCTGC No data
Right 1094733105 12:33200648-33200670 CTGCTTTGTTTACACTGTGAGGG 0: 15
1: 247
2: 607
3: 415
4: 394
1094733102_1094733108 26 Left 1094733102 12:33200629-33200651 CCAAGTTCAAACTTCCTGGCTGC No data
Right 1094733108 12:33200678-33200700 ACCTACTCAAGCCTCAGTAATGG 0: 224
1: 1946
2: 1882
3: 1130
4: 1039

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094733102 Original CRISPR GCAGCCAGGAAGTTTGAACT TGG (reversed) Intergenic
No off target data available for this crispr