ID: 1094736092

View in Genome Browser
Species Human (GRCh38)
Location 12:33235555-33235577
Sequence TGAGCTGTGTTTACTCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094736086_1094736092 7 Left 1094736086 12:33235525-33235547 CCAACCAGTCAATATAAAAAAAC No data
Right 1094736092 12:33235555-33235577 TGAGCTGTGTTTACTCCAGGGGG No data
1094736087_1094736092 3 Left 1094736087 12:33235529-33235551 CCAGTCAATATAAAAAAACCATT No data
Right 1094736092 12:33235555-33235577 TGAGCTGTGTTTACTCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094736092 Original CRISPR TGAGCTGTGTTTACTCCAGG GGG Intergenic
No off target data available for this crispr