ID: 1094738079

View in Genome Browser
Species Human (GRCh38)
Location 12:33258399-33258421
Sequence CCTTACAACCAAAATGCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094738079_1094738082 29 Left 1094738079 12:33258399-33258421 CCATAAGCATTTTGGTTGTAAGG No data
Right 1094738082 12:33258451-33258473 AAAAGAATAAGAATTAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094738079 Original CRISPR CCTTACAACCAAAATGCTTA TGG (reversed) Intergenic
No off target data available for this crispr