ID: 1094738701

View in Genome Browser
Species Human (GRCh38)
Location 12:33264102-33264124
Sequence CCTCTATGGCATAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094738701_1094738706 1 Left 1094738701 12:33264102-33264124 CCTTCCACCTTATGCCATAGAGG No data
Right 1094738706 12:33264126-33264148 CACAGCATTCTTCTCCTCTGAGG No data
1094738701_1094738708 17 Left 1094738701 12:33264102-33264124 CCTTCCACCTTATGCCATAGAGG No data
Right 1094738708 12:33264142-33264164 TCTGAGGAGAACAGTGTGCAAGG No data
1094738701_1094738709 28 Left 1094738701 12:33264102-33264124 CCTTCCACCTTATGCCATAGAGG No data
Right 1094738709 12:33264153-33264175 CAGTGTGCAAGGTGCCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094738701 Original CRISPR CCTCTATGGCATAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr