ID: 1094739028

View in Genome Browser
Species Human (GRCh38)
Location 12:33267622-33267644
Sequence CAGGTTATGAGATGTTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094739028_1094739034 21 Left 1094739028 12:33267622-33267644 CCTGAAAAACATCTCATAACCTG No data
Right 1094739034 12:33267666-33267688 GTCTGCACAACCCTGGGATATGG No data
1094739028_1094739031 15 Left 1094739028 12:33267622-33267644 CCTGAAAAACATCTCATAACCTG No data
Right 1094739031 12:33267660-33267682 AACCCAGTCTGCACAACCCTGGG No data
1094739028_1094739030 14 Left 1094739028 12:33267622-33267644 CCTGAAAAACATCTCATAACCTG No data
Right 1094739030 12:33267659-33267681 AAACCCAGTCTGCACAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094739028 Original CRISPR CAGGTTATGAGATGTTTTTC AGG (reversed) Intergenic
No off target data available for this crispr