ID: 1094741607

View in Genome Browser
Species Human (GRCh38)
Location 12:33296160-33296182
Sequence ATGGACTCCTTGAGAAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094741604_1094741607 26 Left 1094741604 12:33296111-33296133 CCTACTCATCACTAGGCTATAGT No data
Right 1094741607 12:33296160-33296182 ATGGACTCCTTGAGAAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094741607 Original CRISPR ATGGACTCCTTGAGAAATAC AGG Intergenic
No off target data available for this crispr