ID: 1094742343

View in Genome Browser
Species Human (GRCh38)
Location 12:33303849-33303871
Sequence CTGTGATTGTACTAGTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094742343_1094742344 -7 Left 1094742343 12:33303849-33303871 CCTGTACACTAGTACAATCACAG No data
Right 1094742344 12:33303865-33303887 ATCACAGAAAAGTAGATTGCAGG No data
1094742343_1094742345 13 Left 1094742343 12:33303849-33303871 CCTGTACACTAGTACAATCACAG No data
Right 1094742345 12:33303885-33303907 AGGTTTTTATAATGTTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094742343 Original CRISPR CTGTGATTGTACTAGTGTAC AGG (reversed) Intergenic
No off target data available for this crispr