ID: 1094749132

View in Genome Browser
Species Human (GRCh38)
Location 12:33385195-33385217
Sequence CATTAAGTGCAGAAATCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094749132_1094749133 6 Left 1094749132 12:33385195-33385217 CCTTCAGATTTCTGCACTTAATG 0: 1
1: 0
2: 0
3: 18
4: 197
Right 1094749133 12:33385224-33385246 AATGTCATACGCCCAGCCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 22
1094749132_1094749138 20 Left 1094749132 12:33385195-33385217 CCTTCAGATTTCTGCACTTAATG 0: 1
1: 0
2: 0
3: 18
4: 197
Right 1094749138 12:33385238-33385260 AGCCGTCGGTAGGTAACAAAGGG 0: 1
1: 0
2: 0
3: 2
4: 18
1094749132_1094749137 19 Left 1094749132 12:33385195-33385217 CCTTCAGATTTCTGCACTTAATG 0: 1
1: 0
2: 0
3: 18
4: 197
Right 1094749137 12:33385237-33385259 CAGCCGTCGGTAGGTAACAAAGG 0: 1
1: 0
2: 0
3: 0
4: 36
1094749132_1094749134 10 Left 1094749132 12:33385195-33385217 CCTTCAGATTTCTGCACTTAATG 0: 1
1: 0
2: 0
3: 18
4: 197
Right 1094749134 12:33385228-33385250 TCATACGCCCAGCCGTCGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 13

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094749132 Original CRISPR CATTAAGTGCAGAAATCTGA AGG (reversed) Exonic
901301795 1:8205025-8205047 CAGTAGGTGCAGGAATCTGGGGG - Intergenic
902172561 1:14624523-14624545 CATTATGTGCAGAAATATTTAGG + Intronic
903386638 1:22931124-22931146 CATTCAGTGATGAAATATGATGG - Intergenic
903861966 1:26370098-26370120 AAGTAAGTGCAGAGATCTGAGGG + Intronic
906842119 1:49150485-49150507 CTTTAAGAGGAGAAATCTGAGGG + Intronic
910348939 1:86273918-86273940 CAGTAGGTGCAGAAAGCTCAAGG - Intergenic
910552190 1:88487960-88487982 CAGTAAGTGCAAAAATCAAAAGG - Intergenic
914406221 1:147376431-147376453 CATGAAATGCAGAACTCTGCTGG - Intergenic
914742501 1:150477046-150477068 CATTAAGTGCAGAAGTCAAAGGG - Intergenic
916278217 1:163018844-163018866 CATTAAGTGCAGGTCTCTGTTGG - Intergenic
918167778 1:181966790-181966812 AATAAAGTGCACAAATCTTAAGG - Intergenic
919001051 1:191831867-191831889 CATTAAGTTCTGACACCTGATGG + Intergenic
922689626 1:227677980-227678002 CATTAGGGGCAGAAATCACAGGG + Intergenic
924102235 1:240616684-240616706 CATCAAAAGGAGAAATCTGATGG - Intergenic
1063406426 10:5799901-5799923 CTTTAACTGCTGAACTCTGATGG + Intronic
1063819218 10:9815313-9815335 AATTTAGTGCATAAATCTGAAGG - Intergenic
1064953550 10:20881345-20881367 CATTAAGTGCACAAACCTTTGGG + Intronic
1067762005 10:49055440-49055462 CATTATGTGCAGAATCTTGAAGG + Intronic
1067813090 10:49446324-49446346 CAGCCAGTGCAGTAATCTGATGG + Intergenic
1068756700 10:60663149-60663171 CTTTAATGGCAGCAATCTGATGG - Intronic
1069435369 10:68376785-68376807 CATTATGTGCAAAAAAATGAGGG + Intronic
1071299500 10:84245603-84245625 CATTGAGGGCAGAGAGCTGAAGG - Intronic
1071415283 10:85435616-85435638 CATGAACTGGAGAAATCTGATGG - Intergenic
1073344615 10:102773237-102773259 CACTAAGCGCTGATATCTGAGGG - Intronic
1076456971 10:130607010-130607032 CATTAACAGCATAAATCAGAGGG - Intergenic
1077255930 11:1583135-1583157 CATTAATTACAGAACTCAGATGG - Intergenic
1079390398 11:20017315-20017337 CATCAAGTGCAGAGACCAGAGGG - Intronic
1079446587 11:20562285-20562307 AATTAACTGCAGATGTCTGAAGG + Intergenic
1081085846 11:38799678-38799700 AATAAAGTGCAGAGATCTTAAGG - Intergenic
1081358093 11:42138608-42138630 GATTAAGTTTAGAAATCTTAGGG - Intergenic
1082755369 11:57070121-57070143 CAAGATGTGCAGAAATATGAGGG - Intergenic
1085366864 11:75955803-75955825 CCTTAAGTCCAGGAATTTGAGGG + Intronic
1085879519 11:80449260-80449282 CATAAAGTTCAGAAATCCAAAGG - Intergenic
1088800942 11:113306521-113306543 CATTAAGTATAGAAATCTCAAGG + Intergenic
1089036420 11:115398129-115398151 CATTGAATGCAGAAACCTCACGG - Intronic
1090681662 11:129065662-129065684 CATTAAGTGCTAAAATATAACGG - Intronic
1091255024 11:134175899-134175921 CTTTAATTGCAGAAATTTTAAGG - Intronic
1092312507 12:7373772-7373794 TATTAACAGCATAAATCTGATGG + Intronic
1093872814 12:24312644-24312666 CATAAAATGCATAAATCTGTTGG + Intergenic
1094071786 12:26424304-26424326 CCTAAAGTGTAGAACTCTGATGG + Intronic
1094071934 12:26425763-26425785 TATTAACTGTAGAAATCTGTGGG - Intronic
1094749132 12:33385195-33385217 CATTAAGTGCAGAAATCTGAAGG - Exonic
1095524853 12:43113194-43113216 TATTTAATGCAGAAATATGAAGG - Intergenic
1098172155 12:67757943-67757965 CACTAAGTGAAGCAATTTGAAGG + Intergenic
1106694224 13:32153978-32154000 CACTAAGGGCAGAAATAAGATGG - Intronic
1108987005 13:56604544-56604566 AATTTAGTTCAGAAATCTGCTGG + Intergenic
1112600491 13:100850733-100850755 CATTCAGTCAAGAAATCAGAGGG - Intergenic
1113104731 13:106759690-106759712 TATTAAGTCCAGAAATTTGTTGG + Intergenic
1113182172 13:107641922-107641944 CATTAAATCCAGATATCTCAGGG + Intronic
1113546000 13:111151064-111151086 CTTTAAGTGCAAACCTCTGATGG - Intronic
1118404535 14:65411122-65411144 CGTTTAGTACAGAAATCTCATGG + Exonic
1119419731 14:74501420-74501442 AGGTAAGTGCAGAATTCTGATGG - Exonic
1119940507 14:78636106-78636128 CAATCAGTTCAGAAATCAGAGGG - Intronic
1121530359 14:94648500-94648522 CATCATGTGCAGAGATCTCATGG + Intergenic
1123775497 15:23575206-23575228 CATTAAGTCTAGAACTCAGAAGG - Intronic
1125158398 15:36615617-36615639 CACTAAATCCAGAAATCTGAAGG + Intronic
1126257174 15:46641662-46641684 AATTATGGGCAGAAACCTGAAGG - Intergenic
1128679057 15:69633637-69633659 GAATAAGTGGAGAAATATGACGG + Intergenic
1130039985 15:80398225-80398247 CATTTAGCTCAGAAATCTCAGGG - Intronic
1131141664 15:89981455-89981477 GCTTAAGTGGAGAAAGCTGACGG - Intergenic
1132187899 15:99819162-99819184 AATTAAATGGAGATATCTGAGGG + Intergenic
1134441140 16:14300478-14300500 CCTTAATTCCAGAAATCTGGAGG - Intergenic
1135480557 16:22817532-22817554 CATTAACTGCAGAAATCATGGGG + Intronic
1135895442 16:26397026-26397048 AATTAAGTGAAGACACCTGATGG - Intergenic
1137825517 16:51491159-51491181 TATAAAGTGCTGATATCTGATGG + Intergenic
1137933914 16:52615241-52615263 CATTAAGTGCAGGAAACAGTAGG + Intergenic
1138225563 16:55291557-55291579 AATTTAGTGCAGACACCTGATGG + Intergenic
1138526259 16:57609128-57609150 CATTAGGTGCTGGAATCTGATGG + Intergenic
1139269625 16:65670204-65670226 CACAAAGGGGAGAAATCTGAGGG + Intergenic
1144677280 17:17169717-17169739 CATAAAGTGATGAAATCTCAAGG - Intronic
1146025244 17:29314762-29314784 CATATAGTACAGAATTCTGAGGG + Intergenic
1146448666 17:32954158-32954180 CATTAAGTTCAGAAATATAAGGG + Intergenic
1148473781 17:47913406-47913428 CAGTAAGTACAGAAATAAGAGGG - Intronic
1149033947 17:52114250-52114272 CAAAAGGAGCAGAAATCTGAGGG - Intronic
1152996975 18:416744-416766 CTTTAAGTACAGAGACCTGAAGG - Intronic
1155146151 18:23085256-23085278 CTTTCCGTGGAGAAATCTGAAGG - Intergenic
1156428434 18:37043023-37043045 AATTAAGTGCAAAATTCAGAAGG - Intronic
1156952764 18:42923263-42923285 CAGAAACTGCAGAAATCTTAAGG + Intronic
1157226673 18:45872363-45872385 CAGTAAGAACAGAAACCTGATGG + Intronic
1157682751 18:49619725-49619747 CCTTAAGAGCAAAAACCTGATGG - Intergenic
1159595692 18:70380772-70380794 CATTAAGAGCAGAAAATTGTAGG - Intergenic
1159684798 18:71405257-71405279 CCTCAAGTGCAGAAAAATGAAGG + Intergenic
1160551232 18:79694692-79694714 GAAGAAGTGCTGAAATCTGAAGG - Intronic
1165239055 19:34448834-34448856 GGTTCAGTACAGAAATCTGAGGG + Intronic
1168094868 19:54108675-54108697 CATTAAGTACAGAAATCGTCTGG - Intronic
927671107 2:25069667-25069689 CAGTATGTGCAGAAATCTCTAGG + Intronic
928225810 2:29447155-29447177 AATTAAGTCCAGATACCTGATGG + Intronic
930409824 2:51011363-51011385 AATCAAGTGAAGAAATCAGATGG + Intronic
930524294 2:52507421-52507443 CATTCAGTGCATAAAACTCAGGG - Intergenic
930716605 2:54599318-54599340 CATTAAGTGCAGAATTCAACAGG - Intronic
931661624 2:64569776-64569798 CATTTAGTGTTGGAATCTGAAGG + Intronic
933122371 2:78555726-78555748 CATTAAGTGTTAAATTCTGAAGG - Intergenic
933160121 2:79014550-79014572 ACCTAAGTGCAAAAATCTGATGG - Intergenic
933283636 2:80359797-80359819 CACTAAGTTATGAAATCTGATGG + Intronic
935437262 2:103048195-103048217 ATTCAAGTGCTGAAATCTGATGG + Intergenic
936453154 2:112648516-112648538 CCTAAACTGTAGAAATCTGAGGG + Intronic
937696609 2:124815404-124815426 CATTTTGTGCTGAAAGCTGAAGG + Intronic
939333621 2:140796374-140796396 CATTAAGAGGAGCAATCTGTTGG + Intronic
939423914 2:142009502-142009524 CAACACGTGCAAAAATCTGAAGG - Intronic
939656468 2:144832070-144832092 CATTAAGTACAGACTTCTGATGG + Intergenic
941465576 2:165822224-165822246 CATTAAGTGGGGAAAACTGGTGG - Intergenic
942330923 2:174823095-174823117 CATTATGTGCAGAAATTTCTGGG - Intronic
942758712 2:179373016-179373038 CATTAGGTGGAGCACTCTGAAGG - Intergenic
942789986 2:179750016-179750038 GATTAAGTACAGAACTCTAAGGG - Intronic
943183736 2:184577869-184577891 CAGTATGTGCAGAAATCACATGG + Intergenic
944126223 2:196295795-196295817 CTTTAAGCACAGAAATCTTAAGG + Intronic
946613865 2:221488270-221488292 AATTACATGCAGAATTCTGAGGG - Intronic
946940554 2:224765718-224765740 CATCTAGTGCTGAAGTCTGAGGG - Exonic
947142593 2:227033319-227033341 CATGAAGTGCAGAAATACCAGGG + Intronic
1173049401 20:39544854-39544876 CATGAAGTGCAAAAGTCAGAGGG + Intergenic
1175030960 20:55953537-55953559 TATTAAGAGCAAAAATCTTAAGG + Intergenic
1175056895 20:56206800-56206822 CATCAACTGCAGGCATCTGAGGG + Intergenic
1177919483 21:27133100-27133122 CAGTAAGTGCCAAAATCTAAAGG - Intergenic
1177919581 21:27134494-27134516 CAGTAAGTGCCAAAATCTGAAGG + Intergenic
1179129367 21:38620972-38620994 CAATAAATGCTGAAAACTGATGG - Intronic
1180930021 22:19583509-19583531 AATAAAGAGCAGAAAACTGATGG + Intergenic
951248579 3:20368250-20368272 CATTAAGTGCAATAGTTTGAGGG + Intergenic
951500460 3:23380828-23380850 CATAAAGTGCTTAAATCTCATGG - Intronic
952006114 3:28844541-28844563 AATTAAGTGCTTAAATTTGAAGG - Intergenic
953187464 3:40652114-40652136 CTTTAAGTGCAGAAAAGTGAAGG - Intergenic
954935682 3:54324341-54324363 CATTTACTTCAGACATCTGACGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
959433271 3:106282187-106282209 CATTATGTTGAGAATTCTGAAGG + Intergenic
959770666 3:110091117-110091139 GATAAAGTGAAGAAATCTGCAGG - Intergenic
962549410 3:136474453-136474475 GATTAAGTGCAGAGATATGCTGG + Intronic
964222435 3:154362891-154362913 GATTCAGTGCAGAAATATCAGGG + Intronic
964629011 3:158789135-158789157 CATTAAGAGAAAAAATGTGAGGG - Intronic
966694500 3:182776760-182776782 GATCAAGTGGAGAAATCTGCTGG + Intergenic
966802904 3:183781288-183781310 CATTAAGTCCTGGAGTCTGAAGG + Intronic
967216362 3:187213844-187213866 CATTAAATGCAGTGAACTGAGGG - Intergenic
967365815 3:188685470-188685492 AATTTAGTGCCAAAATCTGAGGG + Intronic
967464511 3:189788343-189788365 CTTTAAGTGCATAAATTTTATGG + Intronic
969921235 4:10541707-10541729 CTTTCAGTACAGAAATCTGCTGG - Intronic
970040067 4:11786671-11786693 AGCTAATTGCAGAAATCTGAGGG - Intergenic
970090158 4:12397460-12397482 CTTTAAGTTCAAAAATCTGCTGG + Intergenic
970681778 4:18516892-18516914 TACTAAGTGCATAAATATGATGG - Intergenic
970951381 4:21759915-21759937 CATTGAGAGCAGAAATCTAAAGG - Intronic
973158502 4:46988059-46988081 AATTAAGTGCAAAGGTCTGAAGG - Intronic
976150559 4:82087056-82087078 GATGAAGTGCAGTAATCTCATGG - Intergenic
978191601 4:105919822-105919844 CTTTCAGTAGAGAAATCTGATGG - Intronic
978446348 4:108783892-108783914 AATCTAGTGCAGAATTCTGAGGG - Intergenic
978642724 4:110890757-110890779 CATGTAGTTCAGAAAACTGATGG - Intergenic
978807955 4:112820253-112820275 CCTGAAAAGCAGAAATCTGAAGG - Intronic
979295560 4:119029711-119029733 CATTGAGTACAGAATTTTGAAGG - Intronic
979553295 4:122015836-122015858 TATTAAGTGAAGAAATGTAATGG - Intergenic
980116254 4:128682078-128682100 TTTTAAATGCAGAAATATGAAGG + Intergenic
980288236 4:130808774-130808796 CAGTAAAGGCAGAAATCTCAGGG + Intergenic
980498424 4:133615590-133615612 TGTTAAGGGCAGAAAACTGATGG - Intergenic
981925514 4:150135283-150135305 CCTGAAGTGAAGAAATCTGTTGG + Intronic
983763792 4:171450644-171450666 CATTATGTGCAGAAATCACAAGG - Intergenic
985064525 4:186107135-186107157 CATTAATTGCATAAATGTTAAGG - Intronic
986944991 5:13006570-13006592 TACTAAGGGCAGAAATTTGAAGG + Intergenic
986962330 5:13230315-13230337 CATTAAGTGCTGGCCTCTGAAGG - Intergenic
987548462 5:19345802-19345824 TATTAAATGCAGAATTCTGCTGG + Intergenic
989631007 5:43483202-43483224 TTTTAAGTGCAGACATCTGATGG - Intronic
989724205 5:44568736-44568758 GATTAAGTGCAGAAATATCTGGG - Intergenic
989726483 5:44593162-44593184 CATTAAATACATAAATTTGAAGG - Intergenic
990033201 5:51287036-51287058 ACTGAAGTGCAGCAATCTGATGG - Intergenic
991483143 5:67105345-67105367 AAATAATTGCAGAAAACTGAAGG + Intronic
993136132 5:83966793-83966815 CATGAAATTAAGAAATCTGAGGG + Intronic
993932437 5:93956249-93956271 CATTTGGTGAAGAAATCTCAGGG + Intronic
995210454 5:109531741-109531763 TGTTAAGTGCAGAAATGTCAGGG + Intergenic
996518627 5:124401380-124401402 CATGAAGTTCAGGAATCAGATGG - Intergenic
997467362 5:134097108-134097130 CATTAATTGCAGTGATGTGAAGG - Intergenic
998065360 5:139153595-139153617 CACTAAGGACAGAAATGTGAGGG - Intronic
998705844 5:144759141-144759163 AATAAAGTGCAGAAATCTCCAGG + Intergenic
1001298767 5:170518375-170518397 GAATAAGAGAAGAAATCTGAAGG - Intronic
1003417024 6:5918734-5918756 AACTTAGTGCAGAAACCTGATGG + Intergenic
1004036401 6:11928432-11928454 CATTAACTGCAAAGATATGAAGG + Intergenic
1006696419 6:35934079-35934101 CCTTAAGTGAAGAAATCTGGAGG + Intergenic
1007459513 6:42007899-42007921 CACTCAGTGAAGAAACCTGACGG + Intronic
1007742408 6:44020930-44020952 CATGAAATGAAAAAATCTGAGGG + Intergenic
1008006167 6:46411813-46411835 AATTATGTGCAGAAATGTAATGG + Intronic
1008380103 6:50831643-50831665 CATTAAGATTAGAAATCTGGGGG + Intronic
1010048220 6:71472110-71472132 CAGTAAGTGGAGAAAGTTGAAGG - Intergenic
1010442494 6:75913616-75913638 CAGTAATTTCAAAAATCTGAAGG - Intronic
1010949241 6:82015403-82015425 CATTAAGGGCAGAATTGAGAGGG - Intergenic
1012274035 6:97249761-97249783 AATGAATTGCTGAAATCTGAGGG - Intronic
1012535044 6:100285349-100285371 CATTAAGTGCTAAAATATGTGGG + Intergenic
1021152760 7:17171852-17171874 CATTAAGTGCATAAATATTTAGG - Intergenic
1021487696 7:21184890-21184912 TATTAAGGACAGAAATCAGAAGG + Intergenic
1021495523 7:21270105-21270127 CTTTGCGTGGAGAAATCTGAAGG + Intergenic
1022375645 7:29808121-29808143 CGTTAAGTGCACAAGTCTCAAGG - Intronic
1030694373 7:112568851-112568873 AATTAAGGGCAGAAATCGGCTGG + Intergenic
1031352185 7:120747222-120747244 CATTAAGTTCAGAGGTTTGAGGG + Intronic
1038329370 8:26596005-26596027 CATTAGCTGCAGAAATCACAGGG + Intronic
1038400566 8:27281039-27281061 CAATAAGTACTGAAGTCTGATGG - Intergenic
1039074047 8:33672789-33672811 CATTCAGTCCAGAAACCTCAGGG - Intergenic
1039316840 8:36383008-36383030 TATTATGTTCAGAATTCTGAGGG + Intergenic
1042146463 8:65735250-65735272 AAGCAAGTGCAGAATTCTGATGG - Intronic
1043080299 8:75757430-75757452 TTTTTAGTGGAGAAATCTGATGG - Intergenic
1043194171 8:77269272-77269294 ATATAAGTCCAGAAATCTGAGGG - Intergenic
1044057835 8:87594438-87594460 TATTAAATGAAGAAATATGAGGG + Intronic
1045857849 8:106784451-106784473 CAGTGAGTGAAGAAATCTGGTGG + Intergenic
1046865399 8:119143919-119143941 AATTAAATGCAGAAAACTGAGGG - Intergenic
1047539772 8:125753499-125753521 CATTAAGAGCAAACACCTGAAGG + Intergenic
1049372399 8:142274070-142274092 CATTAAGTCCAGCAAGGTGAGGG - Intronic
1049821573 8:144636876-144636898 CAGTAAGTTCAAAATTCTGATGG - Intergenic
1050974508 9:11920157-11920179 CCTAAAGTGCAGAAAGCTGGGGG + Intergenic
1051074063 9:13209133-13209155 CATTAAGTGAGGCAATCAGATGG + Intronic
1053106324 9:35412015-35412037 CAGTAAGTACGAAAATCTGAAGG - Intergenic
1054904092 9:70399687-70399709 CATTTTGTGCATAAAACTGAAGG - Intronic
1056074876 9:83028143-83028165 CATTAAGTCCAGAAATGTTGGGG + Intronic
1057397579 9:94693578-94693600 CATGAAGTGCACAAATCATAAGG + Intergenic
1059850778 9:118336713-118336735 GATTATGTGCAGATATCTCAAGG - Intergenic
1061760033 9:132844345-132844367 CATTAACTACAGAATCCTGATGG + Intronic
1188115311 X:26235500-26235522 AATTAATTGCAGAAAACTAAGGG + Intergenic
1188460082 X:30415292-30415314 CATTAAGTTCTGAACTATGAGGG - Intergenic
1191650911 X:63536979-63537001 CATGAATTGCAAAAATCTGTGGG - Intergenic
1194314481 X:92358064-92358086 CAGAAAGTGCAGAAGACTGAGGG + Intronic
1195513001 X:105739165-105739187 CATTAAGGGAAAAAATCTGTAGG - Intronic
1196745859 X:119071138-119071160 CATTAAGTGGAAACCTCTGAGGG + Intergenic
1197314440 X:124947221-124947243 CATTAAGTGCAGAGGGCTCAGGG + Intronic
1198927636 X:141816296-141816318 CATTCAGTCCAGAAATATGATGG + Intergenic
1200622538 Y:5469587-5469609 CAGAAAGTGCAGAAGACTGAGGG + Intronic
1201451182 Y:14116406-14116428 CATTACATGCAGCAATGTGAAGG - Intergenic