ID: 1094753394

View in Genome Browser
Species Human (GRCh38)
Location 12:33439301-33439323
Sequence CGCGCTAGGCTGCAAGCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094753394_1094753405 21 Left 1094753394 12:33439301-33439323 CCCGGAGCTTGCAGCCTAGCGCG 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1094753405 12:33439345-33439367 GGACGCGAGCGGAGCCCTCCCGG 0: 1
1: 0
2: 1
3: 9
4: 79
1094753394_1094753404 10 Left 1094753394 12:33439301-33439323 CCCGGAGCTTGCAGCCTAGCGCG 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1094753404 12:33439334-33439356 GCGGAGCGCGAGGACGCGAGCGG 0: 1
1: 0
2: 1
3: 11
4: 113
1094753394_1094753400 -9 Left 1094753394 12:33439301-33439323 CCCGGAGCTTGCAGCCTAGCGCG 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1094753400 12:33439315-33439337 CCTAGCGCGCGGGGTCCCAGCGG 0: 1
1: 0
2: 3
3: 5
4: 56
1094753394_1094753401 0 Left 1094753394 12:33439301-33439323 CCCGGAGCTTGCAGCCTAGCGCG 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1094753401 12:33439324-33439346 CGGGGTCCCAGCGGAGCGCGAGG 0: 1
1: 0
2: 6
3: 6
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094753394 Original CRISPR CGCGCTAGGCTGCAAGCTCC GGG (reversed) Intronic
901965558 1:12863251-12863273 GCCGTTAGCCTGCAAGCTCCTGG + Intronic
902873495 1:19327647-19327669 CCCGCTGGGCTGTAAGCTTCTGG - Intronic
906005198 1:42463313-42463335 CGCGCTCAGCTGCTAGCTGCAGG - Intronic
907593819 1:55701517-55701539 CTCACTAGACTGTAAGCTCCCGG - Intergenic
908401502 1:63775827-63775849 CGTGCTAATCTGAAAGCTCCTGG + Intronic
910434486 1:87191383-87191405 TGCGCAGGGCTGTAAGCTCCGGG + Intergenic
917431607 1:174975200-174975222 CCCACTAGGCTTTAAGCTCCAGG - Intronic
920624987 1:207588241-207588263 CGATCTTGGCTGCAACCTCCTGG + Intronic
921046416 1:211481076-211481098 CTTGCTGGGCTGCAGGCTCCAGG - Intronic
921603601 1:217133339-217133361 GGCGCTAGGCGCCAGGCTCCTGG - Intronic
1062906505 10:1183178-1183200 CTCTCTAGGCTGCGGGCTCCTGG - Exonic
1064393233 10:14959475-14959497 CACGCCCGCCTGCAAGCTCCCGG + Exonic
1066598182 10:37076037-37076059 CGCGCTGGCCTGCAGGCGCCTGG - Intergenic
1074831851 10:117254932-117254954 CAGGCAAGGCTGCAGGCTCCTGG - Intronic
1074865680 10:117543227-117543249 CGCCCTGGGCTCCCAGCTCCTGG - Exonic
1075948841 10:126460258-126460280 CGTGCTAGGCTGTGAGCTCCAGG + Intronic
1078896933 11:15605150-15605172 CCTGCTAGACTACAAGCTCCAGG + Intergenic
1085037319 11:73308285-73308307 CGCCCTTGGCTGCTCGCTCCTGG - Exonic
1085295869 11:75431385-75431407 CCCGCCAGGCTGGGAGCTCCGGG - Intergenic
1087182940 11:95157378-95157400 CGGGCTGGGCTGCCGGCTCCGGG + Intergenic
1088810661 11:113389493-113389515 CCCCCTAGGCTGCAATCTCCCGG - Intronic
1093525718 12:20102130-20102152 GGGGCTGGGCTGCCAGCTCCAGG - Intergenic
1094753394 12:33439301-33439323 CGCGCTAGGCTGCAAGCTCCGGG - Intronic
1096337158 12:50764798-50764820 CCCGCTAGACTGCAAGCTCCAGG - Intronic
1096744400 12:53715987-53716009 GGCTTGAGGCTGCAAGCTCCTGG + Exonic
1096870328 12:54588603-54588625 CGCGCTCGGCTCCCGGCTCCCGG + Exonic
1097263201 12:57731156-57731178 CCCACTAGACTGCAAGTTCCTGG + Intronic
1101416809 12:104515626-104515648 CCCCCTAGACTGTAAGCTCCAGG - Intronic
1101773773 12:107775518-107775540 GGCGCTTGTCTGCCAGCTCCCGG - Exonic
1108287204 13:48920292-48920314 TGCACTAGGCTCCAAGCTCTAGG - Intergenic
1113984769 13:114304816-114304838 CGCGCTCGGAAGCGAGCTCCTGG - Exonic
1116653744 14:47626587-47626609 CGCGCTGGCCCGCAAGCGCCGGG - Intronic
1117548534 14:56812007-56812029 CGCACGAGGCAGCAAGCTCTCGG + Intergenic
1121183561 14:91947663-91947685 CGCGCTCGGCTGCGAGCGCCCGG + Exonic
1121985055 14:98497264-98497286 CTCGCTAGGCTGCAGCTTCCTGG - Intergenic
1125163237 15:36672450-36672472 ACTGCTAGGATGCAAGCTCCTGG - Intronic
1126777458 15:52112245-52112267 CGCGCCTGGCTGCAGGCTCAGGG - Exonic
1129522008 15:76192009-76192031 CGCGCTCGGCAGCCAGGTCCAGG - Exonic
1130362685 15:83206676-83206698 AGAGGTAGGCTGCAAGCTCTCGG + Intronic
1132548413 16:544151-544173 CGAGCTGGGCTGCAGTCTCCTGG - Intronic
1142178911 16:88657769-88657791 CCCGCTGGGCCGCCAGCTCCAGG - Intronic
1144856028 17:18268407-18268429 CGCCCTAGGCTGCCGGGTCCTGG + Intergenic
1147374398 17:40015442-40015464 GGGGCTGGGCTGCAGGCTCCGGG - Exonic
1154164762 18:12006470-12006492 CTGGCTAGGCTGAAAGCTCCAGG + Intronic
1158193333 18:54856030-54856052 CCCACTAGGGTGCAAGCTCTAGG - Intronic
1159260515 18:66006285-66006307 CGCACTGGCCTGCAAGCCCCAGG + Intergenic
1163713667 19:18861890-18861912 GGCGCCAGGCCCCAAGCTCCCGG + Intronic
925695460 2:6572843-6572865 CTCGCTGGGCTGTGAGCTCCAGG + Intergenic
926786679 2:16524949-16524971 TGCCCTAGACTGTAAGCTCCAGG + Intergenic
929018153 2:37522669-37522691 CTCTCTAGACTGGAAGCTCCAGG + Intergenic
929936790 2:46298934-46298956 AGCGCGGGGCTGGAAGCTCCAGG - Intronic
935344553 2:102093850-102093872 CGCGCGGGGCAGCAGGCTCCCGG + Intronic
936010756 2:108923863-108923885 CCCACTAGGCTGCAGGCTCTGGG - Intronic
936653286 2:114454857-114454879 ACCGCTAGACTGCAAGCTCCTGG + Intronic
939329947 2:140744827-140744849 TCCTCTAGGATGCAAGCTCCAGG + Intronic
943024196 2:182608490-182608512 CGCGCTGGCCCGCAAGCGCCTGG - Intergenic
947428705 2:230007013-230007035 AGCTCCAGGCTGCAGGCTCCAGG - Intronic
1168856428 20:1012576-1012598 CCGGCTAGGCTGCAAGCTCCAGG - Intergenic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1172817925 20:37704188-37704210 CCCATTAGACTGCAAGCTCCAGG - Intronic
1172952282 20:38729811-38729833 CTCACTAGACTGTAAGCTCCCGG - Intergenic
1174383117 20:50170274-50170296 TGCACTAGACTGTAAGCTCCAGG - Intergenic
1174844393 20:53929086-53929108 CCCGCTAGACTGTAAGATCCAGG + Intergenic
1180179798 21:46112883-46112905 CGCGCCAGGCTGCCGACTCCTGG + Intronic
1180226749 21:46398010-46398032 CCCGCTCGGCTGCCTGCTCCTGG - Exonic
1181407230 22:22693670-22693692 CTGCCTTGGCTGCAAGCTCCTGG - Intergenic
1184090293 22:42289772-42289794 CGGGGCAGGCTGCAGGCTCCTGG - Intronic
1185315472 22:50177126-50177148 CGCGCTGGGCTGGGAGTTCCTGG + Exonic
951107967 3:18768114-18768136 CCCACTAGACTGTAAGCTCCAGG - Intergenic
954725797 3:52608593-52608615 CATGATAGGCTGTAAGCTCCAGG + Intronic
956114518 3:65904763-65904785 CTCACTAGACTGGAAGCTCCAGG + Intronic
956751256 3:72345773-72345795 CTCTCTGGGCTGCAAGCTCCTGG + Intergenic
957062025 3:75489964-75489986 CCAGCTAGACTGCATGCTCCTGG + Intergenic
960939118 3:122922165-122922187 GGCGCGGGGCTGCAAGCTTCCGG - Intronic
965058459 3:163752467-163752489 TGCGCTGGGCTGCAATCTCAGGG + Intergenic
969655493 4:8495354-8495376 CACGCTGGGCTGCAGCCTCCTGG + Intergenic
969854738 4:9990097-9990119 CCCGCTTGGCTGCATGCTTCAGG + Intronic
970817915 4:20179354-20179376 CGCACTGGCCTGCAAGCACCAGG + Intergenic
972966737 4:44519613-44519635 CCCACTAGACTGTAAGCTCCAGG - Intergenic
973144286 4:46805122-46805144 CGCGCTGGCCTCCAAGCACCGGG + Intronic
976690635 4:87863996-87864018 CGCGCTGGCCTGCAAGCACCAGG + Intergenic
980827348 4:138088899-138088921 CGTGCTGGCCTGCAAGCGCCGGG + Intergenic
988729951 5:33962213-33962235 CGTGTTAGGCTGCAAATTCCTGG + Intronic
989178400 5:38552964-38552986 CTCTATAGGCTGGAAGCTCCAGG - Intronic
998143208 5:139711237-139711259 CGCGCTGGGCTGCGCGCGCCTGG - Intergenic
1001600468 5:172924903-172924925 CCCCCTAGACTGGAAGCTCCAGG - Intronic
1002778893 6:351644-351666 CGCGGCTGGCTGCATGCTCCTGG - Intergenic
1006707403 6:36032730-36032752 CCCACTAGGCTGTAAGTTCCAGG - Intronic
1015684391 6:135843245-135843267 CCCGCTAGCCTGCAGGCTTCAGG - Intergenic
1015721920 6:136251154-136251176 CCCGCTGGCCTGTAAGCTCCAGG - Intergenic
1019723156 7:2585878-2585900 CGAGCTATCCTGCAAGCACCTGG + Intronic
1022097658 7:27150920-27150942 CGCGCCAGGCTGCAAGAGGCGGG + Intronic
1026015649 7:66668976-66668998 CTAGCTAGCCCGCAAGCTCCTGG - Intronic
1026892063 7:73988142-73988164 CTAGCTAGCCCGCAAGCTCCCGG - Intergenic
1029550317 7:101233985-101234007 CCAGCTAGGATGTAAGCTCCCGG + Intronic
1029903932 7:104071820-104071842 TGCGCTGGCCTGCAAGCACCAGG - Intergenic
1031971504 7:128068105-128068127 CCAGCTTGGCTGCAGGCTCCAGG + Intronic
1033227149 7:139571282-139571304 CGGGCGAGGCTGAGAGCTCCAGG + Exonic
1035686446 8:1526953-1526975 CGAGTTAGGCTGCAAGCAGCGGG + Intronic
1043001655 8:74767355-74767377 CTCACAAGGCTACAAGCTCCAGG - Intronic
1045017149 8:98009886-98009908 CCCACTGGCCTGCAAGCTCCTGG + Intronic
1053653890 9:40196563-40196585 CGCCCTAGGCTCCAGGCTCCAGG + Intergenic
1053904276 9:42825727-42825749 CGCCCCAGGCTCCAGGCTCCAGG + Intergenic
1054366009 9:64342779-64342801 CGCCCCAGGCTCCAGGCTCCAGG + Intergenic
1054530708 9:66179787-66179809 CGCCCCAGGCTCCAGGCTCCAGG - Intergenic
1054673637 9:67832508-67832530 CGCCCCAGGCTCCAGGCTCCAGG + Intergenic
1057379438 9:94554779-94554801 GGCTCCAGGCTCCAAGCTCCAGG + Intergenic
1060660782 9:125404085-125404107 CACGCCAGGCTGTGAGCTCCTGG + Intergenic
1060724347 9:125997259-125997281 CTCGCTGGCCTGCAAGGTCCTGG + Intergenic
1060989594 9:127840770-127840792 GGAGCCAGGCTGCAGGCTCCAGG - Intronic
1061162407 9:128902867-128902889 CGCCCTGGGCTGGCAGCTCCAGG - Intronic
1062419125 9:136470927-136470949 CGCGCTAGGCTGCGCCTTCCAGG - Intronic
1186405482 X:9298335-9298357 GGCTTCAGGCTGCAAGCTCCTGG - Intergenic
1186479181 X:9883155-9883177 CCCACTCAGCTGCAAGCTCCTGG - Intronic