ID: 1094754731

View in Genome Browser
Species Human (GRCh38)
Location 12:33454786-33454808
Sequence GGCCCTCTTGGTATACAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 12, 3: 12, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094754731 Original CRISPR GGCCCTCTTGGTATACAGAA CGG (reversed) Intergenic
903922781 1:26812872-26812894 GGCCCTCTTGGGAGACAGAGAGG - Intergenic
909951217 1:81722439-81722461 GGCCCTCTTGGCATACAAAACGG - Intronic
910470734 1:87549807-87549829 AGTCATCTTGGTACACAGAATGG - Intergenic
912299750 1:108502789-108502811 GGCTCTCTTGGCACACAGAATGG - Intergenic
912549501 1:110475823-110475845 GGTCCTCTTGGGAGAAAGAATGG - Intergenic
915190201 1:154143737-154143759 GTGCCTCTTGTTATAAAGAAAGG - Intronic
915854427 1:159366659-159366681 GGCACCTTTGGAATACAGAAAGG - Intergenic
920917127 1:210266782-210266804 GGCCCTCTTGGCATACAAAATGG + Intergenic
921689704 1:218134230-218134252 GGCCCTCTTAGCTGACAGAAGGG - Intergenic
1073354775 10:102845202-102845224 GGTGCTCTTGGTATAAAGATAGG + Intergenic
1073926486 10:108521949-108521971 GCCCCTCCTGGTAAACAGAATGG - Intergenic
1079189034 11:18262424-18262446 GGCCCTCTTTGCATACAAAATGG - Intergenic
1081485459 11:43524163-43524185 GGCCATCTTTTTAAACAGAAAGG - Intergenic
1082043290 11:47704604-47704626 TGGCCTCTTGGTAGACAAAATGG + Exonic
1084302734 11:68261990-68262012 GGCCCTCTGGGTATATGGCATGG + Exonic
1086158611 11:83695771-83695793 GGCCTTCTAGGTAGACAGACAGG - Intronic
1087156872 11:94913474-94913496 GGCCCTCTTGGCATACAAAATGG - Intergenic
1088683764 11:112267907-112267929 GGCCCTCTTGGCATACAAAATGG + Intronic
1090744277 11:129694085-129694107 GGCCCACTTGGGACACAGAATGG + Intergenic
1090938586 11:131367383-131367405 GCTCTTCTTGCTATACAGAATGG + Intergenic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1091593437 12:1858874-1858896 AGGGCTCTTGGTCTACAGAATGG - Intronic
1094754731 12:33454786-33454808 GGCCCTCTTGGTATACAGAACGG - Intergenic
1097500045 12:60390627-60390649 GGCCCTCTGAGTATTCAAAAAGG + Intergenic
1101578095 12:106016339-106016361 GGCCCTCTTGGCATACAAAATGG - Intergenic
1102492025 12:113295217-113295239 GGCCCCCTTGTTTTACAGAGGGG - Intronic
1105582197 13:21708949-21708971 GGACCACATGGAATACAGAATGG - Intergenic
1108413347 13:50172519-50172541 GGCCCTCTTGGCATACAAAATGG - Intronic
1109786198 13:67178179-67178201 ATCTCTCTTGGTATACAGATAGG - Intronic
1111204244 13:84983564-84983586 GTCCCCCGTGTTATACAGAAAGG - Intergenic
1112057177 13:95700464-95700486 GGACCTCTTGGTATAAGGAATGG - Intronic
1113441719 13:110334224-110334246 GGCCTTCTTGACATTCAGAAAGG + Intronic
1118771258 14:68944128-68944150 GGCCCCCTGGGGATGCAGAATGG + Intronic
1121967829 14:98326801-98326823 GGCCCTATGGGTATACAGGTTGG - Intergenic
1124990902 15:34672487-34672509 GGCCATCTTGGGGTACAGGAGGG + Intergenic
1126884419 15:53134411-53134433 TGCTCTCATTGTATACAGAAGGG + Intergenic
1127359142 15:58229699-58229721 GGCCCTTTTGTGATACAGACTGG + Intronic
1128768903 15:70267298-70267320 GGCCCTTTGAGGATACAGAAGGG - Intergenic
1131288706 15:91085727-91085749 GTTCCTCTTTGTATACAGTAAGG + Intergenic
1131977992 15:97964694-97964716 GGCTAACTTGGAATACAGAAAGG - Intronic
1137285929 16:47015772-47015794 GCCCTTATTTGTATACAGAATGG - Intergenic
1137393009 16:48097306-48097328 GGCCCCCTTGATCTATAGAAAGG + Intronic
1141691254 16:85597944-85597966 GGCCCTCAGGGTATTCAGAAGGG + Intergenic
1152931584 17:83112940-83112962 GCCCTTCCTGGTTTACAGAAAGG + Intergenic
1153223840 18:2883134-2883156 GGCCCTCTTGGGATTCTGCAGGG + Intronic
1156157251 18:34317587-34317609 GGCCATCTTTGTATACAGCTGGG - Intergenic
1157733994 18:50030423-50030445 GTCCCTCTTGGTAAACAGGAGGG - Intronic
1158200622 18:54935537-54935559 GGCCCACTTGGTATTTACAAGGG - Intronic
1168340463 19:55620453-55620475 GGCCCACTGGGTGAACAGAAAGG + Intergenic
927658306 2:24971113-24971135 GGCCGTCTTGGAATTCATAAGGG + Intronic
928232166 2:29507796-29507818 GGCCCTCATGGTACAGAGAGGGG + Intronic
931134193 2:59377971-59377993 AGCCCTCTGGGTAGACACAAGGG - Intergenic
934761580 2:96859679-96859701 TTCCCTCTTGGTACCCAGAAAGG + Intergenic
935709221 2:105882363-105882385 GGCCTTCTACGTACACAGAATGG - Intronic
936377526 2:111954732-111954754 AGCCCTTTGGGTCTACAGAATGG - Intronic
943111060 2:183606584-183606606 GGCAATTCTGGTATACAGAAAGG + Intergenic
943432827 2:187825782-187825804 GGCCCTCTTGGCATACAAAATGG - Intergenic
943700619 2:190985226-190985248 AGCCCTCTTGGCACACAGCAAGG + Intronic
1171100224 20:22375801-22375823 GGCCCTTGTGGGATACAGAATGG - Intergenic
1183881524 22:40835805-40835827 GGCCCTCTTGGCATACAAAATGG + Exonic
954579001 3:51692954-51692976 GGCCCTCTGGGCCTAGAGAAAGG + Intronic
962413320 3:135160705-135160727 GGCCATGTTGGTATACAAGAAGG + Intronic
963293405 3:143517765-143517787 GGCCCTCTTGGCATACAAAATGG + Intronic
980321632 4:131287361-131287383 TGCCCTTTTGGTAAACAGCAGGG - Intergenic
981728924 4:147877059-147877081 GGCCCTGTTGGTTGTCAGAAGGG + Intronic
985763454 5:1763802-1763824 GGCAGTCTTGGTTTACCGAACGG + Intergenic
988495956 5:31746460-31746482 GTCATTCTTGGTATACACAAGGG + Intronic
991044221 5:62206277-62206299 GGCCCTCATGGCATCCAGGATGG - Intergenic
993055668 5:82976507-82976529 TGCCCTCTTGGCATACAAAATGG - Intergenic
997779707 5:136644348-136644370 TGCCCACTTGGCATACAGAGAGG - Intergenic
998385681 5:141755960-141755982 GGCCCTTTTGTTTTACAGATAGG - Intergenic
1000704883 5:164498553-164498575 GAGCCTTTTGGTAAACAGAATGG - Intergenic
1000939313 5:167341004-167341026 GACCCTCTTGGTTTGCAGAATGG + Intronic
1015025963 6:128532743-128532765 GGTCATCTTGGTACACAGACTGG - Intergenic
1018570591 6:165205479-165205501 GGCCCTTATAGTCTACAGAATGG - Intergenic
1032588429 7:133170052-133170074 GGCCCTCTTGGCATACAAAATGG + Intergenic
1033217358 7:139502893-139502915 AGCCGTCTTGGCATACAAAATGG - Intergenic
1034274817 7:149819466-149819488 GGCGCTCTTGGTAGGCAGTAAGG - Intergenic
1034700531 7:153091831-153091853 GGCCCACTGCGAATACAGAAAGG + Intergenic
1037534280 8:19810435-19810457 GGAGCACCTGGTATACAGAAGGG + Intergenic
1039897613 8:41727344-41727366 TCCTCTCTTGGTTTACAGAAAGG - Exonic
1047990660 8:130283200-130283222 GGCCCTCTTTGTAGAGAGCATGG + Intronic
1048322168 8:133408448-133408470 GGCCCTCTTGGCATACAAAATGG - Intergenic
1050635369 9:7606686-7606708 AGCCCACTTGCAATACAGAAAGG - Intergenic
1052661759 9:31441989-31442011 AGCCCTCTTGGAAAACAGTATGG + Intergenic
1056993262 9:91430536-91430558 GCCCCTCTTGGTACACAGTCTGG - Intergenic
1057945847 9:99327511-99327533 GGTCTTCTTGGTAAACAGAGAGG - Intergenic
1059447179 9:114345769-114345791 GGCCCACTGGGTATATGGAAAGG + Intronic
1060118936 9:120969746-120969768 GGGCCCCTTGGAATACAGAAAGG + Intronic
1192040412 X:67614175-67614197 GGCCATCGTGGTTTAAAGAATGG + Intronic
1194388597 X:93288378-93288400 GGCCCTCTTGGCATACAAAAGGG + Intergenic
1197037184 X:121888284-121888306 CCCCCTCTTGGTATTCTGAATGG - Intergenic
1197093614 X:122568999-122569021 GGCTCTCATTGTATACAGTATGG - Intergenic
1198149292 X:133892516-133892538 GACCTTCCTGGTATGCAGAATGG - Intronic
1198176118 X:134156656-134156678 GGGGCTATTGGTATCCAGAAAGG + Intergenic
1198680004 X:139171083-139171105 GGCCCTGTGGGAATTCAGAAGGG - Intronic